Incidental Mutation 'R5603:Exoc6b'
ID439131
Institutional Source Beutler Lab
Gene Symbol Exoc6b
Ensembl Gene ENSMUSG00000033769
Gene Nameexocyst complex component 6B
SynonymsSec15b, Sec15l2, 4930569O18Rik, G430127E12Rik
MMRRC Submission 043155-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R5603 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location84618487-85069513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84835144 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 625 (D625G)
Ref Sequence ENSEMBL: ENSMUSP00000125312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160197]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051531
Predicted Effect possibly damaging
Transcript: ENSMUST00000160197
AA Change: D625G

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125312
Gene: ENSMUSG00000033769
AA Change: D625G

DomainStartEndE-ValueType
coiled coil region 79 118 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
Pfam:Sec15 464 770 4.5e-105 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a part of the evolutionarily conserved exocyst, a multimeric protein complex necessary for exocytosis, which in turn, is crucial for cell growth, polarity and migration. Disruption of this gene may be associated with phenotypes exhibiting multiple symptoms including intellectual disability and developmental delay (DD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Baiap2l1 A G 5: 144,265,977 S509P probably damaging Het
Bud31 T C 5: 145,144,959 I52T possibly damaging Het
Cacna1g C T 11: 94,439,752 S979N possibly damaging Het
Cacna2d4 T A 6: 119,244,285 W253R probably damaging Het
Ccna1 A G 3: 55,050,909 Y118H probably damaging Het
Cct8l1 A G 5: 25,516,499 T71A probably benign Het
Chaf1b A G 16: 93,892,795 T19A probably damaging Het
Col6a2 A T 10: 76,596,769 V850D probably damaging Het
Cpsf2 C A 12: 101,998,631 Q513K probably benign Het
Dnah5 T G 15: 28,419,932 V3792G probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Gad1 C A 2: 70,589,829 F352L probably damaging Het
Gm13083 T A 4: 143,617,496 C455* probably null Het
Gm5422 T A 10: 31,250,844 noncoding transcript Het
Grin2b T C 6: 135,923,397 E162G probably damaging Het
Grm6 T A 11: 50,856,959 F333I probably damaging Het
Heatr5a A G 12: 51,877,575 F1952L probably benign Het
Ighv1-42 C T 12: 114,937,512 probably benign Het
Itgb6 T C 2: 60,620,362 T578A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mfsd14b T C 13: 65,073,606 K291E probably benign Het
Mllt6 T C 11: 97,673,505 L379P probably damaging Het
Mtmr6 A T 14: 60,285,001 K183* probably null Het
Mylk A G 16: 34,956,492 N1345S probably benign Het
Nab2 A T 10: 127,665,121 M1K probably null Het
Ngly1 C A 14: 16,260,762 Q149K probably benign Het
Npy6r T A 18: 44,276,585 S358T probably damaging Het
Pbld2 A G 10: 63,071,449 T156A probably benign Het
Pik3cd A T 4: 149,658,855 C263S probably benign Het
Ptk2b A T 14: 66,172,065 Y507* probably null Het
Rbm25 C T 12: 83,664,216 R368* probably null Het
Rnf207 T C 4: 152,312,394 Y396C probably damaging Het
Skint2 T A 4: 112,649,764 V328E possibly damaging Het
Slc3a2 A G 19: 8,713,728 V7A probably benign Het
Spata18 G A 5: 73,671,232 V265I probably benign Het
Tmem120b T A 5: 123,101,642 V108D possibly damaging Het
Ugt1a2 T C 1: 88,201,426 Y264H probably damaging Het
Other mutations in Exoc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Exoc6b APN 6 84989453 missense probably benign 0.08
IGL01148:Exoc6b APN 6 84908226 missense probably benign 0.18
IGL01804:Exoc6b APN 6 84908166 missense probably damaging 0.98
IGL01817:Exoc6b APN 6 85069338 missense probably damaging 1.00
IGL01912:Exoc6b APN 6 84625174 missense probably damaging 1.00
IGL02441:Exoc6b APN 6 85005008 missense probably damaging 1.00
IGL02947:Exoc6b APN 6 84858429 missense probably benign
IGL02996:Exoc6b APN 6 84908213 missense probably benign 0.01
IGL03132:Exoc6b APN 6 84791264 missense possibly damaging 0.46
IGL03338:Exoc6b APN 6 84844130 missense probably damaging 0.99
R0003:Exoc6b UTSW 6 84854699 critical splice donor site probably null
R0732:Exoc6b UTSW 6 84855522 missense probably damaging 0.99
R1137:Exoc6b UTSW 6 84908223 missense probably benign
R1381:Exoc6b UTSW 6 84835117 missense probably benign
R1723:Exoc6b UTSW 6 85069344 missense probably damaging 1.00
R1838:Exoc6b UTSW 6 84853678 missense probably benign 0.04
R1866:Exoc6b UTSW 6 84851914 missense probably damaging 0.99
R2122:Exoc6b UTSW 6 84621482 missense probably benign 0.01
R2138:Exoc6b UTSW 6 84989482 missense probably damaging 1.00
R2357:Exoc6b UTSW 6 84989339 missense possibly damaging 0.60
R2987:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R2988:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R3415:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R3417:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R4364:Exoc6b UTSW 6 85003179 intron probably benign
R4610:Exoc6b UTSW 6 85003159 intron probably benign
R4624:Exoc6b UTSW 6 84854809 splice site probably benign
R4845:Exoc6b UTSW 6 84835137 missense probably benign 0.04
R5366:Exoc6b UTSW 6 84890531 missense probably benign
R5635:Exoc6b UTSW 6 84851927 missense probably damaging 0.99
R5728:Exoc6b UTSW 6 84860191 missense probably damaging 1.00
R6188:Exoc6b UTSW 6 84855497 missense probably damaging 0.99
R7030:Exoc6b UTSW 6 84848825 missense probably damaging 0.99
R7058:Exoc6b UTSW 6 84854722 missense probably damaging 1.00
R7259:Exoc6b UTSW 6 84848810 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGGACATTAAAGAGGTTGCTGG -3'
(R):5'- CTGTGTTCCTAAGTGGGCATAG -3'

Sequencing Primer
(F):5'- TGCTGGCAACTTAAATCAGAAATGAG -3'
(R):5'- AGATGTGTGGTGGCTCTATGACATAC -3'
Posted On2016-10-26