Incidental Mutation 'R5604:Ipo9'
ID439160
Institutional Source Beutler Lab
Gene Symbol Ipo9
Ensembl Gene ENSMUSG00000041879
Gene Nameimportin 9
Synonyms
MMRRC Submission 043156-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5604 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135382312-135430499 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135402245 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 486 (L486F)
Ref Sequence ENSEMBL: ENSMUSP00000124779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041023] [ENSMUST00000161032] [ENSMUST00000161189] [ENSMUST00000161838]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041023
AA Change: L486F

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036093
Gene: ENSMUSG00000041879
AA Change: L486F

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
IBN_N 43 119 3.83e-7 SMART
low complexity region 911 922 N/A INTRINSIC
low complexity region 978 990 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159017
Predicted Effect probably damaging
Transcript: ENSMUST00000161032
AA Change: L486F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124779
Gene: ENSMUSG00000041879
AA Change: L486F

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
IBN_N 43 119 3.83e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161135
Predicted Effect probably benign
Transcript: ENSMUST00000161189
SMART Domains Protein: ENSMUSP00000124492
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
SCOP:d1i6la_ 21 52 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161704
Predicted Effect probably benign
Transcript: ENSMUST00000161838
SMART Domains Protein: ENSMUSP00000125646
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
SCOP:d1i6la_ 21 52 4e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,390 N164I possibly damaging Het
4933402J07Rik C A 8: 87,568,497 R88S possibly damaging Het
Abca1 A T 4: 53,067,168 probably null Het
Abca13 T A 11: 9,566,279 I4406K probably damaging Het
Adam6b T A 12: 113,490,800 Y412* probably null Het
Ahcyl2 C T 6: 29,908,367 H370Y probably damaging Het
Ahi1 A G 10: 20,987,005 Y693C probably damaging Het
Anapc4 T A 5: 52,841,734 Y129* probably null Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Antxr2 T C 5: 97,948,310 K372E probably damaging Het
Arhgef1 C T 7: 24,912,785 H198Y probably benign Het
Barhl2 T C 5: 106,455,546 E249G probably benign Het
C2cd5 T C 6: 143,012,021 E987G probably benign Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccser1 C T 6: 61,313,804 T490M probably damaging Het
Cd8b1 T C 6: 71,326,175 V78A probably benign Het
Cdc25c A G 18: 34,733,648 Y374H probably damaging Het
Cmya5 C T 13: 93,092,763 R1939H probably benign Het
Cyp2d40 A G 15: 82,764,055 F19S probably damaging Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
E4f1 A G 17: 24,444,144 I729T probably damaging Het
Endou A C 15: 97,720,919 S75A probably benign Het
Epas1 C T 17: 86,805,772 H129Y probably damaging Het
Grm1 T A 10: 10,746,735 N415Y probably damaging Het
Hdc A T 2: 126,594,663 S429R probably benign Het
Hnf4g C T 3: 3,657,126 Q447* probably null Het
Htr6 C T 4: 139,061,503 A414T probably benign Het
Insig1 T C 5: 28,075,082 L224P probably damaging Het
Irak2 T A 6: 113,690,831 S458T possibly damaging Het
Irs2 A G 8: 11,005,007 S1142P possibly damaging Het
Kirrel T A 3: 87,089,155 N379I possibly damaging Het
L3mbtl4 T A 17: 68,777,922 D609E probably benign Het
Lama3 A G 18: 12,439,348 T537A probably benign Het
Lce1i A T 3: 92,777,749 V40E unknown Het
Mprip T A 11: 59,758,467 V999D probably benign Het
Myd88 G T 9: 119,339,763 T85K possibly damaging Het
Olfr395 T A 11: 73,907,027 H155L probably benign Het
Padi6 A T 4: 140,731,162 M473K probably damaging Het
Pcdh12 T A 18: 38,268,882 S97C probably damaging Het
Pkd1l1 T A 11: 8,833,877 D2026V probably damaging Het
Plcxd1 T C 5: 110,102,585 V264A probably benign Het
Plekha4 T C 7: 45,549,156 S558P probably damaging Het
Ppm1a T A 12: 72,790,681 M334K probably benign Het
Ppp1r13l T C 7: 19,375,599 S684P possibly damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prl2a1 T C 13: 27,806,386 probably benign Het
Ptch1 T C 13: 63,525,122 K753E probably benign Het
Qrich1 A G 9: 108,559,303 probably null Het
Ror2 G A 13: 53,117,165 R373C probably benign Het
Rtn4 C A 11: 29,708,140 L765I probably damaging Het
Sema3a T C 5: 13,473,520 probably null Het
Setd2 T A 9: 110,604,216 D62E probably damaging Het
Ss18 A T 18: 14,636,520 Y327N unknown Het
Ticam1 G A 17: 56,271,756 T113I probably benign Het
Tnrc6a A G 7: 123,174,236 I1134V probably damaging Het
Top3b T G 16: 16,889,535 Y526* probably null Het
Tph2 T C 10: 115,090,709 E384G probably damaging Het
Ttll11 A T 2: 35,817,786 I503N probably benign Het
Zfp87 T G 13: 67,517,826 K172N probably damaging Het
Other mutations in Ipo9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Ipo9 APN 1 135400059 missense probably damaging 1.00
IGL01611:Ipo9 APN 1 135386693 missense possibly damaging 0.76
IGL01941:Ipo9 APN 1 135408073 missense possibly damaging 0.95
IGL01944:Ipo9 APN 1 135405886 missense probably damaging 0.98
IGL01959:Ipo9 APN 1 135420355 critical splice acceptor site probably null
IGL02649:Ipo9 APN 1 135385934 missense possibly damaging 0.92
IGL02697:Ipo9 APN 1 135390576 missense probably benign 0.00
IGL03286:Ipo9 APN 1 135407078 intron probably benign
FR4304:Ipo9 UTSW 1 135386275 small insertion probably benign
FR4304:Ipo9 UTSW 1 135386279 nonsense probably null
FR4340:Ipo9 UTSW 1 135386269 small insertion probably benign
FR4340:Ipo9 UTSW 1 135386271 small insertion probably benign
FR4548:Ipo9 UTSW 1 135386275 small insertion probably benign
FR4589:Ipo9 UTSW 1 135386266 small insertion probably benign
FR4589:Ipo9 UTSW 1 135386281 small insertion probably benign
FR4976:Ipo9 UTSW 1 135386281 small insertion probably benign
R0111:Ipo9 UTSW 1 135405924 missense probably damaging 0.97
R0238:Ipo9 UTSW 1 135404336 splice site probably benign
R0239:Ipo9 UTSW 1 135404336 splice site probably benign
R0279:Ipo9 UTSW 1 135420363 intron probably benign
R0704:Ipo9 UTSW 1 135386268 small deletion probably benign
R1070:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1282:Ipo9 UTSW 1 135402292 missense possibly damaging 0.48
R1467:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1467:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1728:Ipo9 UTSW 1 135386268 small insertion probably benign
R1728:Ipo9 UTSW 1 135386271 small insertion probably benign
R1728:Ipo9 UTSW 1 135402250 missense probably benign
R1729:Ipo9 UTSW 1 135386268 small insertion probably benign
R1729:Ipo9 UTSW 1 135402250 missense probably benign
R1730:Ipo9 UTSW 1 135386268 small insertion probably benign
R1730:Ipo9 UTSW 1 135402250 missense probably benign
R1739:Ipo9 UTSW 1 135386268 small insertion probably benign
R1739:Ipo9 UTSW 1 135402250 missense probably benign
R1762:Ipo9 UTSW 1 135386268 small insertion probably benign
R1762:Ipo9 UTSW 1 135402250 missense probably benign
R1783:Ipo9 UTSW 1 135386268 small insertion probably benign
R1783:Ipo9 UTSW 1 135402250 missense probably benign
R1784:Ipo9 UTSW 1 135386268 small insertion probably benign
R1784:Ipo9 UTSW 1 135402250 missense probably benign
R1785:Ipo9 UTSW 1 135386268 small insertion probably benign
R1785:Ipo9 UTSW 1 135386281 small insertion probably benign
R1785:Ipo9 UTSW 1 135402250 missense probably benign
R1899:Ipo9 UTSW 1 135400146 missense probably damaging 0.99
R2049:Ipo9 UTSW 1 135386268 small insertion probably benign
R2049:Ipo9 UTSW 1 135402250 missense probably benign
R2130:Ipo9 UTSW 1 135386268 small insertion probably benign
R2130:Ipo9 UTSW 1 135402250 missense probably benign
R2131:Ipo9 UTSW 1 135386268 small insertion probably benign
R2131:Ipo9 UTSW 1 135402250 missense probably benign
R2133:Ipo9 UTSW 1 135386268 small insertion probably benign
R2133:Ipo9 UTSW 1 135386275 small insertion probably benign
R2133:Ipo9 UTSW 1 135402250 missense probably benign
R2136:Ipo9 UTSW 1 135394285 missense probably damaging 0.98
R2141:Ipo9 UTSW 1 135386268 small insertion probably benign
R2141:Ipo9 UTSW 1 135402250 missense probably benign
R2142:Ipo9 UTSW 1 135386268 small insertion probably benign
R2142:Ipo9 UTSW 1 135386275 small insertion probably benign
R2142:Ipo9 UTSW 1 135386282 small insertion probably benign
R2142:Ipo9 UTSW 1 135402250 missense probably benign
R2356:Ipo9 UTSW 1 135406817 missense probably benign 0.00
R2923:Ipo9 UTSW 1 135400129 missense probably benign 0.25
R3161:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R3162:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R3162:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R4086:Ipo9 UTSW 1 135388690 unclassified probably benign
R4679:Ipo9 UTSW 1 135394169 missense probably benign
R4816:Ipo9 UTSW 1 135406550 missense probably benign 0.21
R4956:Ipo9 UTSW 1 135404222 critical splice donor site probably null
R5052:Ipo9 UTSW 1 135388611 unclassified probably null
R5055:Ipo9 UTSW 1 135402359 nonsense probably null
R5230:Ipo9 UTSW 1 135420070 missense probably damaging 1.00
R5240:Ipo9 UTSW 1 135389606 unclassified probably benign
R5257:Ipo9 UTSW 1 135385435 missense probably damaging 1.00
R5340:Ipo9 UTSW 1 135385432 missense probably benign 0.00
R5560:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5602:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5654:Ipo9 UTSW 1 135385472 nonsense probably null
R6018:Ipo9 UTSW 1 135390536 critical splice donor site probably null
R6128:Ipo9 UTSW 1 135390573 missense possibly damaging 0.90
R6841:Ipo9 UTSW 1 135386308 missense probably benign
Y5405:Ipo9 UTSW 1 135386269 small insertion probably benign
Y5405:Ipo9 UTSW 1 135386275 small insertion probably benign
Y5405:Ipo9 UTSW 1 135386284 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACTAGGCAGGGGTAATATAGGAT -3'
(R):5'- GGTAGTGCTCCCACATGATAGAT -3'

Sequencing Primer
(F):5'- GGATACTTGACAACCTCTTCTGG -3'
(R):5'- GTGCTCCCACATGATAGATGATTG -3'
Posted On2016-10-26