Incidental Mutation 'R5606:Trim21'
ID 439293
Institutional Source Beutler Lab
Gene Symbol Trim21
Ensembl Gene ENSMUSG00000030966
Gene Name tripartite motif-containing 21
Synonyms Ro52, Ssa1
MMRRC Submission 043157-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5606 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 102207127-102214689 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 102208813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 302 (R302P)
Ref Sequence ENSEMBL: ENSMUSP00000102526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033264] [ENSMUST00000098227] [ENSMUST00000106913] [ENSMUST00000217478]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033264
AA Change: R302P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033264
Gene: ENSMUSG00000030966
AA Change: R302P

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098227
SMART Domains Protein: ENSMUSP00000095829
Gene: ENSMUSG00000073977

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.7e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 225 1.2e-11 PFAM
Pfam:7tm_1 43 294 1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106913
AA Change: R302P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102526
Gene: ENSMUSG00000030966
AA Change: R302P

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209907
Predicted Effect probably benign
Transcript: ENSMUST00000217478
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The encoded protein is part of the RoSSA ribonucleoprotein, which includes a single polypeptide and one of four small RNA molecules. The RoSSA particle localizes to both the cytoplasm and the nucleus. RoSSA interacts with autoantigens in patients with Sjogren syndrome and systemic lupus erythematosus. Alternatively spliced transcript variants for this gene have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Unmanipulated homozygous mice are normal, but leads to tissue inflammation and systemic autoimmunity in vivo and reduced number of CD11c+ dendritic cells from mutant bone marrow in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 A G 19: 20,699,731 (GRCm39) S75P probably damaging Het
Ankib1 A T 5: 3,751,907 (GRCm39) I711N probably damaging Het
Ankmy2 A G 12: 36,215,920 (GRCm39) N40S probably benign Het
Armc8 T C 9: 99,418,315 (GRCm39) K80E probably benign Het
Blm C A 7: 80,110,580 (GRCm39) probably null Het
Cand1 C A 10: 119,047,359 (GRCm39) Q710H possibly damaging Het
Ckap2l A T 2: 129,127,959 (GRCm39) I73N probably damaging Het
Ddx27 T A 2: 166,861,886 (GRCm39) D129E probably benign Het
Dnm3 T C 1: 162,113,587 (GRCm39) E491G probably damaging Het
Fgd6 C A 10: 93,974,190 (GRCm39) Y1310* probably null Het
Hnrnph3 C T 10: 62,855,222 (GRCm39) R21H possibly damaging Het
Hs3st4 C A 7: 123,996,365 (GRCm39) Q344K probably damaging Het
Hyal3 T C 9: 107,462,265 (GRCm39) S100P probably benign Het
Map3k19 G A 1: 127,750,694 (GRCm39) R886C probably benign Het
Mmrn2 G A 14: 34,119,581 (GRCm39) D187N probably damaging Het
Myo5c G A 9: 75,182,790 (GRCm39) A810T probably damaging Het
Noxa1 T A 2: 24,976,292 (GRCm39) E332V possibly damaging Het
Or10al7 T C 17: 38,365,693 (GRCm39) T264A probably damaging Het
Or12j5 T A 7: 140,083,713 (GRCm39) I220F probably damaging Het
Or51r1 T C 7: 102,228,481 (GRCm39) S260P probably damaging Het
Or7c70 A G 10: 78,683,395 (GRCm39) M118T probably benign Het
Parg T A 14: 31,984,693 (GRCm39) V241E probably damaging Het
Pitrm1 T A 13: 6,610,101 (GRCm39) V391D probably damaging Het
Plch1 A T 3: 63,648,108 (GRCm39) V421E probably benign Het
Slc27a2 C T 2: 126,406,610 (GRCm39) A98V probably damaging Het
Spta1 A T 1: 174,047,468 (GRCm39) H1704L probably damaging Het
Tbpl2 G A 2: 23,977,245 (GRCm39) P258S possibly damaging Het
Thoc2l T C 5: 104,669,744 (GRCm39) I1422T probably benign Het
Tlr11 T C 14: 50,599,717 (GRCm39) C568R probably benign Het
Tmem260 T A 14: 48,722,437 (GRCm39) M324K probably damaging Het
Tmprss11g T A 5: 86,635,269 (GRCm39) T402S probably damaging Het
Uox T A 3: 146,316,057 (GRCm39) Y21* probably null Het
Vmn1r74 A G 7: 11,580,822 (GRCm39) M41V probably benign Het
Vmn2r59 A C 7: 41,695,318 (GRCm39) S365A probably benign Het
Zfp345 A T 2: 150,316,788 (GRCm39) Y6* probably null Het
Zpld2 A C 4: 133,927,523 (GRCm39) V410G probably benign Het
Other mutations in Trim21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Trim21 APN 7 102,208,805 (GRCm39) missense probably damaging 1.00
IGL01729:Trim21 APN 7 102,213,100 (GRCm39) missense probably damaging 0.97
IGL02680:Trim21 APN 7 102,208,870 (GRCm39) missense probably benign 0.44
IGL03349:Trim21 APN 7 102,212,484 (GRCm39) missense probably benign 0.00
R1508:Trim21 UTSW 7 102,208,783 (GRCm39) missense possibly damaging 0.52
R1662:Trim21 UTSW 7 102,211,105 (GRCm39) nonsense probably null
R2904:Trim21 UTSW 7 102,209,178 (GRCm39) missense probably benign 0.00
R4482:Trim21 UTSW 7 102,213,140 (GRCm39) nonsense probably null
R5480:Trim21 UTSW 7 102,208,463 (GRCm39) missense probably benign 0.05
R6130:Trim21 UTSW 7 102,212,498 (GRCm39) missense possibly damaging 0.95
R6214:Trim21 UTSW 7 102,208,646 (GRCm39) missense probably damaging 0.96
R6215:Trim21 UTSW 7 102,208,646 (GRCm39) missense probably damaging 0.96
R6291:Trim21 UTSW 7 102,213,289 (GRCm39) missense probably damaging 1.00
R6731:Trim21 UTSW 7 102,208,419 (GRCm39) missense probably damaging 1.00
R7612:Trim21 UTSW 7 102,208,742 (GRCm39) missense probably benign 0.01
R8008:Trim21 UTSW 7 102,209,183 (GRCm39) missense probably benign 0.01
R8491:Trim21 UTSW 7 102,208,689 (GRCm39) missense probably benign 0.12
R8784:Trim21 UTSW 7 102,208,675 (GRCm39) missense probably benign 0.00
R8991:Trim21 UTSW 7 102,212,908 (GRCm39) missense probably benign
R9380:Trim21 UTSW 7 102,212,992 (GRCm39) missense probably damaging 1.00
R9730:Trim21 UTSW 7 102,213,247 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CGGGACTGAGTGAAAACTGC -3'
(R):5'- AGAGTAACTGTGGGTCATTTCC -3'

Sequencing Primer
(F):5'- GGACTGAGTGAAAACTGCCCTTTC -3'
(R):5'- GTAACTGTGGGTCATTTCCTCACATG -3'
Posted On 2016-10-26