Incidental Mutation 'R5607:Cenpe'
ID439324
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission 043271-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5607 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 135235076 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 662 (S662*)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
Predicted Effect probably null
Transcript: ENSMUST00000062893
AA Change: S662*
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: S662*

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Meta Mutation Damage Score 0.6356 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Ajap1 T A 4: 153,432,204 T227S possibly damaging Het
Ankmy1 A G 1: 92,877,018 F851S probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bmpr1b C A 3: 141,857,522 M220I possibly damaging Het
Cacna1e T A 1: 154,471,340 N1027I probably benign Het
Cacng4 A T 11: 107,734,784 V327E probably damaging Het
Casp1 T C 9: 5,303,143 V199A probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Ctnna1 A G 18: 35,249,742 D647G probably benign Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Exoc6 T A 19: 37,578,529 V258D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G A 1: 174,609,811 C1116Y probably damaging Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Mcm6 T C 1: 128,355,589 T60A probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Mmp14 T C 14: 54,439,412 Y428H probably damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Myo9a T C 9: 59,863,944 V933A probably damaging Het
Nepn A T 10: 52,401,137 D323V probably benign Het
Nrf1 C T 6: 30,126,246 A150V probably damaging Het
Nxpe5 A G 5: 138,239,771 T199A probably benign Het
Obscn T G 11: 59,122,848 K1150Q probably benign Het
Olfr1354 A G 10: 78,917,099 I86M possibly damaging Het
Olfr536 A C 7: 140,504,405 V18G probably benign Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr617 G A 7: 103,584,299 W92* probably null Het
Olfr862 T A 9: 19,883,976 M110L probably benign Het
Otop1 G A 5: 38,294,504 G184S possibly damaging Het
Pkp2 G T 16: 16,260,375 D494Y probably damaging Het
Pop5 G A 5: 115,240,201 R68Q probably damaging Het
Ppp1r13b T C 12: 111,833,789 D518G probably benign Het
Preb G T 5: 30,959,963 probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rag1 G A 2: 101,643,792 T335I probably damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Sf3a3 A T 4: 124,714,953 D20V probably damaging Het
Slco1b2 A G 6: 141,685,586 N649D probably benign Het
Smarcal1 A G 1: 72,586,213 D173G probably benign Het
Smg7 A G 1: 152,843,234 L914P probably damaging Het
Tbc1d32 A T 10: 56,129,150 S796T possibly damaging Het
Tex14 A G 11: 87,522,578 T1052A probably benign Het
Tspan1 A G 4: 116,164,080 V109A possibly damaging Het
Ttbk2 A G 2: 120,806,824 V51A possibly damaging Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Ubr2 G T 17: 46,934,200 C1633* probably null Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Vmn2r25 T C 6: 123,828,359 E513G possibly damaging Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGCCCTTGACGCTAAGAAAG -3'
(R):5'- GGGAACATTCTCAATTCCTTTGGG -3'

Sequencing Primer
(F):5'- AGAGTCAGCCTTCCTTAGAAGTG -3'
(R):5'- TTTAAGTCAGGGAGCAGATGTC -3'
Posted On2016-10-26