Incidental Mutation 'R0496:Ctgf'
ID43942
Institutional Source Beutler Lab
Gene Symbol Ctgf
Ensembl Gene ENSMUSG00000019997
Gene Nameconnective tissue growth factor
SynonymsHcs24, Ccn2, Fisp12, hypertrophic chondrocyte-specific gene product 24
MMRRC Submission 038692-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0496 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24595442-24598683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24597515 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 317 (M317I)
Ref Sequence ENSEMBL: ENSMUSP00000020171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020171] [ENSMUST00000129142] [ENSMUST00000176228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020171
AA Change: M317I

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020171
Gene: ENSMUSG00000019997
AA Change: M317I

DomainStartEndE-ValueType
IB 26 96 1.45e-25 SMART
VWC 102 165 8.52e-22 SMART
TSP1 199 242 7.27e-7 SMART
CT 260 329 1.17e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125158
Predicted Effect probably benign
Transcript: ENSMUST00000129142
SMART Domains Protein: ENSMUSP00000135212
Gene: ENSMUSG00000019997

DomainStartEndE-ValueType
IB 3 73 1.45e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141076
Predicted Effect probably benign
Transcript: ENSMUST00000176228
SMART Domains Protein: ENSMUSP00000135147
Gene: ENSMUSG00000019997

DomainStartEndE-ValueType
IB 26 96 1.45e-25 SMART
VWC 102 165 8.52e-22 SMART
TSP1 199 242 7.27e-7 SMART
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitogen that is secreted by vascular endothelial cells. The encoded protein plays a role in chondrocyte proliferation and differentiation, cell adhesion in many cell types, and is related to platelet-derived growth factor. Certain polymorphisms in this gene have been linked with a higher incidence of systemic sclerosis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice die at birth from respiratory failure due to axial skeletal defects and pulmonary hypoplasia associated with reduced cell proliferation, enhanced apoptosis and altered pneumocyte maturation. Osteogenesis is impaired due to impaired chondrogenesis and growth plate angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,244 K1065E probably damaging Het
4932438A13Rik A G 3: 36,987,635 T2721A probably damaging Het
4933402N03Rik T C 7: 131,146,131 N44S probably benign Het
Abca13 A G 11: 9,291,701 D1188G probably benign Het
Abcb11 C T 2: 69,277,884 probably benign Het
Abcc8 A T 7: 46,108,820 I1274N probably damaging Het
Adamtsl1 G A 4: 86,341,198 C827Y probably damaging Het
Agap3 T A 5: 24,501,243 V369E probably damaging Het
Ankrd13b G A 11: 77,473,041 R195C probably damaging Het
Ap3b1 A G 13: 94,472,938 probably benign Het
Arhgef40 A T 14: 52,004,907 probably benign Het
Atad5 A G 11: 80,100,356 I692V probably benign Het
Atp5b G T 10: 128,086,174 R310L possibly damaging Het
AY358078 A T 14: 51,803,532 M103L unknown Het
Bcl9l T G 9: 44,509,518 V1370G probably benign Het
Bglap3 T A 3: 88,369,137 Q38L probably damaging Het
Cd38 T C 5: 43,868,891 F6L probably damaging Het
Cela3a A C 4: 137,404,468 V138G probably damaging Het
Clvs1 T A 4: 9,424,241 I229N probably damaging Het
Cpne1 G A 2: 156,079,419 H16Y probably damaging Het
Ctc1 T C 11: 69,035,507 L1069P probably damaging Het
Dgkd G A 1: 87,936,900 S996N probably null Het
Dnah9 A T 11: 66,075,135 M1685K probably null Het
Dnajb12 C T 10: 59,879,801 R42* probably null Het
Dock5 T C 14: 67,817,518 Q633R probably damaging Het
Dync2h1 A G 9: 7,155,180 M868T probably benign Het
Enpp1 G T 10: 24,672,052 H208Q probably benign Het
Epha7 T A 4: 28,821,292 D152E probably damaging Het
Fancd2 T C 6: 113,555,130 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gm10964 A T 3: 103,739,429 probably null Het
Gm7075 G T 10: 63,421,602 C46* probably null Het
Gpbar1 T C 1: 74,278,981 F128L probably benign Het
Gsx2 T A 5: 75,077,065 M226K probably benign Het
Gucd1 T C 10: 75,511,266 D50G possibly damaging Het
Has1 A G 17: 17,843,746 Y544H probably benign Het
Hc A T 2: 35,013,571 Y1024N probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ift122 T A 6: 115,905,902 H659Q probably benign Het
Itga2 T C 13: 114,853,899 Q902R probably benign Het
Itgb2l T C 16: 96,434,701 K181E possibly damaging Het
Jak3 A T 8: 71,682,397 H558L probably damaging Het
Kcnh8 A G 17: 52,725,858 T58A probably benign Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt33a C T 11: 100,012,329 probably benign Het
Magi2 A T 5: 20,661,359 probably benign Het
Map4 G A 9: 110,039,850 probably benign Het
Map4k4 T A 1: 40,006,822 S754T probably damaging Het
Mapk8ip3 A G 17: 24,914,450 probably benign Het
Mib1 A G 18: 10,804,773 S918G probably benign Het
Mipol1 T A 12: 57,457,177 V377D probably damaging Het
Mlh1 T C 9: 111,241,556 T364A probably benign Het
Mta1 C T 12: 113,131,321 Q400* probably null Het
Mthfd1l C G 10: 4,090,006 R806G probably benign Het
Myh13 C A 11: 67,348,815 N730K probably damaging Het
Myom1 A G 17: 71,084,306 K937E probably damaging Het
Naxd T C 8: 11,510,224 probably benign Het
Negr1 G T 3: 157,016,267 K159N probably damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1170 A T 2: 88,224,155 Y292* probably null Het
Olfr137 A G 17: 38,304,658 S268P probably damaging Het
Olfr397 T C 11: 73,964,880 S91P probably benign Het
Olfr584 T C 7: 103,085,590 I19T probably damaging Het
Olfr620 C T 7: 103,611,997 A119T probably benign Het
Pcsk6 G A 7: 65,927,249 S58N probably benign Het
Pdzrn3 G A 6: 101,150,570 T1045I possibly damaging Het
Pitrm1 T C 13: 6,568,714 L641P probably damaging Het
Pkd1l1 G T 11: 8,929,430 H474N probably damaging Het
Pltp A G 2: 164,852,461 probably benign Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Racgap1 A T 15: 99,639,832 probably benign Het
Rhbg A G 3: 88,254,498 V50A probably benign Het
Rnf135 G A 11: 80,183,950 V12M probably damaging Het
Rufy2 T C 10: 62,993,170 V117A probably damaging Het
Safb A G 17: 56,605,630 M866V probably benign Het
Slc35c2 G T 2: 165,280,815 T183K probably damaging Het
Slc39a7 A G 17: 34,029,538 L377P probably damaging Het
Slit1 G A 19: 41,608,311 probably benign Het
Spaca9 G A 2: 28,693,010 H133Y probably damaging Het
Spout1 A G 2: 30,174,971 F339S probably benign Het
St6gal2 A G 17: 55,482,014 I16M probably damaging Het
Stat2 T C 10: 128,276,509 M6T probably benign Het
Swt1 T A 1: 151,411,270 H157L probably benign Het
Syne2 A G 12: 76,038,940 N147D possibly damaging Het
Tmem2 A T 19: 21,797,345 N117I possibly damaging Het
Tmem222 A T 4: 133,277,591 M45K possibly damaging Het
Tmem30a T A 9: 79,777,285 H95L probably damaging Het
Tns3 A C 11: 8,547,262 probably benign Het
Trpm3 A G 19: 22,698,778 I103V probably benign Het
Ube2n T C 10: 95,541,344 F57S probably benign Het
Vil1 T C 1: 74,421,340 S219P possibly damaging Het
Wdfy4 A G 14: 33,140,738 probably benign Het
Wdr7 T C 18: 63,791,843 S966P probably benign Het
Wnt8a A G 18: 34,544,847 N103D probably damaging Het
Zfp523 G A 17: 28,200,445 E186K possibly damaging Het
Zfp791 A T 8: 85,109,980 D418E probably benign Het
Zscan20 A G 4: 128,591,889 V192A probably benign Het
Other mutations in Ctgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Ctgf APN 10 24596409 missense probably damaging 1.00
IGL02994:Ctgf APN 10 24596865 missense probably damaging 1.00
PIT4131001:Ctgf UTSW 10 24596090 missense probably damaging 0.97
R0443:Ctgf UTSW 10 24595803 splice site probably benign
R0538:Ctgf UTSW 10 24596466 missense probably damaging 1.00
R1599:Ctgf UTSW 10 24597399 missense probably benign 0.08
R1721:Ctgf UTSW 10 24596797 missense probably damaging 1.00
R2095:Ctgf UTSW 10 24596479 missense probably benign 0.41
R2230:Ctgf UTSW 10 24596473 missense possibly damaging 0.61
R2322:Ctgf UTSW 10 24596834 missense probably damaging 1.00
R4913:Ctgf UTSW 10 24597327 missense probably damaging 1.00
R5697:Ctgf UTSW 10 24597456 missense probably benign
R6705:Ctgf UTSW 10 24595955 missense probably damaging 0.99
R7067:Ctgf UTSW 10 24596975 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GGCAAATGAAACTCCCAGTCTCTCC -3'
(R):5'- GGCACTGTGCGCTAATGAACAAC -3'

Sequencing Primer
(F):5'- CTGTCTTCCTTAGAAGGGCAAAAAG -3'
(R):5'- AACTGTCTCGAAACCAGTGTCTG -3'
Posted On2013-05-29