Incidental Mutation 'R0496:Gucd1'
ID43947
Institutional Source Beutler Lab
Gene Symbol Gucd1
Ensembl Gene ENSMUSG00000033416
Gene Nameguanylyl cyclase domain containing 1
Synonyms
MMRRC Submission 038692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R0496 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75351111-75517972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75511266 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 50 (D50G)
Ref Sequence ENSEMBL: ENSMUSP00000151443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039796] [ENSMUST00000118936] [ENSMUST00000123505] [ENSMUST00000136763] [ENSMUST00000138122] [ENSMUST00000145890] [ENSMUST00000147269] [ENSMUST00000219774]
Predicted Effect probably benign
Transcript: ENSMUST00000039796
AA Change: D50G

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043000
Gene: ENSMUSG00000033416
AA Change: D50G

DomainStartEndE-ValueType
Pfam:Peptidase_C39_2 20 206 8.2e-14 PFAM
Pfam:Guanylate_cyc_2 22 235 2.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118936
AA Change: D11G

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113976
Gene: ENSMUSG00000033416
AA Change: D11G

DomainStartEndE-ValueType
Pfam:Peptidase_C39_2 1 167 1.1e-8 PFAM
Pfam:Guanylate_cyc_2 1 197 7.8e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123505
SMART Domains Protein: ENSMUSP00000117292
Gene: ENSMUSG00000033416

DomainStartEndE-ValueType
Pfam:Guanylate_cyc_2 1 93 9.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128419
AA Change: D41G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121405
Gene: ENSMUSG00000033416
AA Change: D41G

DomainStartEndE-ValueType
Pfam:Peptidase_C39_2 12 155 2.6e-9 PFAM
Pfam:Guanylate_cyc_2 14 125 5.4e-49 PFAM
Pfam:Guanylate_cyc_2 120 160 9.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129307
Predicted Effect probably benign
Transcript: ENSMUST00000136763
Predicted Effect silent
Transcript: ENSMUST00000138122
Predicted Effect probably benign
Transcript: ENSMUST00000145890
AA Change: D50G

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123254
Gene: ENSMUSG00000033416
AA Change: D50G

DomainStartEndE-ValueType
Pfam:Peptidase_C39_2 20 206 2.6e-10 PFAM
Pfam:Guanylate_cyc_2 22 210 4e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147269
AA Change: D11G

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118894
Gene: ENSMUSG00000033416
AA Change: D11G

DomainStartEndE-ValueType
Pfam:Guanylate_cyc_2 1 135 7.3e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153125
AA Change: D5G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117061
Gene: ENSMUSG00000033416
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Guanylate_cyc_2 2 91 2.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000219774
AA Change: D50G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (99/101)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,244 K1065E probably damaging Het
4932438A13Rik A G 3: 36,987,635 T2721A probably damaging Het
4933402N03Rik T C 7: 131,146,131 N44S probably benign Het
Abca13 A G 11: 9,291,701 D1188G probably benign Het
Abcb11 C T 2: 69,277,884 probably benign Het
Abcc8 A T 7: 46,108,820 I1274N probably damaging Het
Adamtsl1 G A 4: 86,341,198 C827Y probably damaging Het
Agap3 T A 5: 24,501,243 V369E probably damaging Het
Ankrd13b G A 11: 77,473,041 R195C probably damaging Het
Ap3b1 A G 13: 94,472,938 probably benign Het
Arhgef40 A T 14: 52,004,907 probably benign Het
Atad5 A G 11: 80,100,356 I692V probably benign Het
Atp5b G T 10: 128,086,174 R310L possibly damaging Het
AY358078 A T 14: 51,803,532 M103L unknown Het
Bcl9l T G 9: 44,509,518 V1370G probably benign Het
Bglap3 T A 3: 88,369,137 Q38L probably damaging Het
Cd38 T C 5: 43,868,891 F6L probably damaging Het
Cela3a A C 4: 137,404,468 V138G probably damaging Het
Clvs1 T A 4: 9,424,241 I229N probably damaging Het
Cpne1 G A 2: 156,079,419 H16Y probably damaging Het
Ctc1 T C 11: 69,035,507 L1069P probably damaging Het
Ctgf G T 10: 24,597,515 M317I possibly damaging Het
Dgkd G A 1: 87,936,900 S996N probably null Het
Dnah9 A T 11: 66,075,135 M1685K probably null Het
Dnajb12 C T 10: 59,879,801 R42* probably null Het
Dock5 T C 14: 67,817,518 Q633R probably damaging Het
Dync2h1 A G 9: 7,155,180 M868T probably benign Het
Enpp1 G T 10: 24,672,052 H208Q probably benign Het
Epha7 T A 4: 28,821,292 D152E probably damaging Het
Fancd2 T C 6: 113,555,130 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gm10964 A T 3: 103,739,429 probably null Het
Gm7075 G T 10: 63,421,602 C46* probably null Het
Gpbar1 T C 1: 74,278,981 F128L probably benign Het
Gsx2 T A 5: 75,077,065 M226K probably benign Het
Has1 A G 17: 17,843,746 Y544H probably benign Het
Hc A T 2: 35,013,571 Y1024N probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ift122 T A 6: 115,905,902 H659Q probably benign Het
Itga2 T C 13: 114,853,899 Q902R probably benign Het
Itgb2l T C 16: 96,434,701 K181E possibly damaging Het
Jak3 A T 8: 71,682,397 H558L probably damaging Het
Kcnh8 A G 17: 52,725,858 T58A probably benign Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt33a C T 11: 100,012,329 probably benign Het
Magi2 A T 5: 20,661,359 probably benign Het
Map4 G A 9: 110,039,850 probably benign Het
Map4k4 T A 1: 40,006,822 S754T probably damaging Het
Mapk8ip3 A G 17: 24,914,450 probably benign Het
Mib1 A G 18: 10,804,773 S918G probably benign Het
Mipol1 T A 12: 57,457,177 V377D probably damaging Het
Mlh1 T C 9: 111,241,556 T364A probably benign Het
Mta1 C T 12: 113,131,321 Q400* probably null Het
Mthfd1l C G 10: 4,090,006 R806G probably benign Het
Myh13 C A 11: 67,348,815 N730K probably damaging Het
Myom1 A G 17: 71,084,306 K937E probably damaging Het
Naxd T C 8: 11,510,224 probably benign Het
Negr1 G T 3: 157,016,267 K159N probably damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1170 A T 2: 88,224,155 Y292* probably null Het
Olfr137 A G 17: 38,304,658 S268P probably damaging Het
Olfr397 T C 11: 73,964,880 S91P probably benign Het
Olfr584 T C 7: 103,085,590 I19T probably damaging Het
Olfr620 C T 7: 103,611,997 A119T probably benign Het
Pcsk6 G A 7: 65,927,249 S58N probably benign Het
Pdzrn3 G A 6: 101,150,570 T1045I possibly damaging Het
Pitrm1 T C 13: 6,568,714 L641P probably damaging Het
Pkd1l1 G T 11: 8,929,430 H474N probably damaging Het
Pltp A G 2: 164,852,461 probably benign Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Racgap1 A T 15: 99,639,832 probably benign Het
Rhbg A G 3: 88,254,498 V50A probably benign Het
Rnf135 G A 11: 80,183,950 V12M probably damaging Het
Rufy2 T C 10: 62,993,170 V117A probably damaging Het
Safb A G 17: 56,605,630 M866V probably benign Het
Slc35c2 G T 2: 165,280,815 T183K probably damaging Het
Slc39a7 A G 17: 34,029,538 L377P probably damaging Het
Slit1 G A 19: 41,608,311 probably benign Het
Spaca9 G A 2: 28,693,010 H133Y probably damaging Het
Spout1 A G 2: 30,174,971 F339S probably benign Het
St6gal2 A G 17: 55,482,014 I16M probably damaging Het
Stat2 T C 10: 128,276,509 M6T probably benign Het
Swt1 T A 1: 151,411,270 H157L probably benign Het
Syne2 A G 12: 76,038,940 N147D possibly damaging Het
Tmem2 A T 19: 21,797,345 N117I possibly damaging Het
Tmem222 A T 4: 133,277,591 M45K possibly damaging Het
Tmem30a T A 9: 79,777,285 H95L probably damaging Het
Tns3 A C 11: 8,547,262 probably benign Het
Trpm3 A G 19: 22,698,778 I103V probably benign Het
Ube2n T C 10: 95,541,344 F57S probably benign Het
Vil1 T C 1: 74,421,340 S219P possibly damaging Het
Wdfy4 A G 14: 33,140,738 probably benign Het
Wdr7 T C 18: 63,791,843 S966P probably benign Het
Wnt8a A G 18: 34,544,847 N103D probably damaging Het
Zfp523 G A 17: 28,200,445 E186K possibly damaging Het
Zfp791 A T 8: 85,109,980 D418E probably benign Het
Zscan20 A G 4: 128,591,889 V192A probably benign Het
Other mutations in Gucd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2126:Gucd1 UTSW 10 75512088 missense probably damaging 1.00
R4248:Gucd1 UTSW 10 75509828 missense probably damaging 1.00
R4657:Gucd1 UTSW 10 75511125 missense probably benign 0.40
R4720:Gucd1 UTSW 10 75509660 missense probably damaging 1.00
R5001:Gucd1 UTSW 10 75517202 unclassified probably null
R5580:Gucd1 UTSW 10 75511134 missense possibly damaging 0.93
R6010:Gucd1 UTSW 10 75420766 intron probably benign
R7130:Gucd1 UTSW 10 75512117 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCCCTACAGTGCAGAAAGATGCAG -3'
(R):5'- CAACTTCCCCAGGTTCACATAGTCC -3'

Sequencing Primer
(F):5'- AAGGCCACCTGTCTGTTG -3'
(R):5'- TGAAAGCCTCAGGTTGTACTC -3'
Posted On2013-05-29