Incidental Mutation 'R4911:Rapgef6'
ID439487
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene NameRap guanine nucleotide exchange factor (GEF) 6
SynonymsPDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 042513-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4911 (G1)
Quality Score200
Status Validated
Chromosome11
Chromosomal Location54522847-54699285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54622317 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 122 (E122D)
Ref Sequence ENSEMBL: ENSMUSP00000151509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000108895] [ENSMUST00000207429] [ENSMUST00000218995]
Predicted Effect probably benign
Transcript: ENSMUST00000094536
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101206
AA Change: E269D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: E269D

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102743
AA Change: E269D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: E269D

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108895
AA Change: E269D

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533
AA Change: E269D

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149372
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: E269D

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably damaging
Transcript: ENSMUST00000218995
AA Change: E122D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220269
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (149/153)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 132 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,170,939 probably null Het
4430402I18Rik G A 19: 28,897,503 probably benign Het
Aacs A G 5: 125,506,160 D260G possibly damaging Het
Aadacl4 T A 4: 144,613,792 L29H probably damaging Het
Abca7 T C 10: 80,012,188 probably null Het
Adgre1 G A 17: 57,447,832 M643I possibly damaging Het
Adgrl2 A T 3: 148,890,463 M79K probably damaging Het
Ankrd55 T A 13: 112,323,039 probably null Het
Arhgap21 A G 2: 20,858,989 I1257T probably damaging Het
Arhgap26 T A 18: 38,993,637 probably benign Het
Arhgap39 A G 15: 76,737,805 S199P probably damaging Het
Arhgef5 A G 6: 43,272,828 D171G probably benign Het
Atp7a T C X: 106,120,374 V1305A probably damaging Het
B3gnt3 T A 8: 71,692,934 R263S probably benign Het
B9d1 A C 11: 61,507,671 D59A probably benign Het
Bag2 A T 1: 33,748,276 I55N probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bbs2 A T 8: 94,089,115 D174E probably damaging Het
Bmp8b T C 4: 123,115,237 W203R probably damaging Het
Cacnb2 A T 2: 14,981,340 E359D possibly damaging Het
Camp T A 9: 109,847,583 probably null Het
Casp4 C T 9: 5,328,580 probably benign Het
Ccdc110 A T 8: 45,942,907 T612S probably benign Het
Cd209b T A 8: 3,926,640 probably null Het
Cemip T C 7: 83,983,253 D367G probably damaging Het
Cers5 T A 15: 99,747,079 N131I probably damaging Het
Chd5 T G 4: 152,360,672 V370G probably damaging Het
Cipc C A 12: 86,952,757 Q20K probably benign Het
Cnr2 T A 4: 135,917,201 F197I possibly damaging Het
Col7a1 G A 9: 108,975,219 G2233S unknown Het
Dcdc2b T A 4: 129,611,267 I125F possibly damaging Het
Ddi2 A G 4: 141,684,402 S400P probably benign Het
Ddx31 C A 2: 28,904,684 T664K probably benign Het
Dhx30 C A 9: 110,100,924 G35C probably damaging Het
Dmxl2 G A 9: 54,411,653 T1576I probably damaging Het
Dnah1 T C 14: 31,295,323 Y1510C probably damaging Het
Dnah2 C T 11: 69,499,104 probably null Het
Dock10 C A 1: 80,606,236 G163C probably damaging Het
Edar T C 10: 58,621,324 N144S probably benign Het
Elavl2 T A 4: 91,308,678 E54D possibly damaging Het
Enam T G 5: 88,502,314 S561A probably benign Het
Ercc5 C A 1: 44,166,871 H315N possibly damaging Het
Esp31 A G 17: 38,644,661 E65G possibly damaging Het
Faap100 T C 11: 120,372,113 I806M probably benign Het
Fam159a T C 4: 108,377,461 T70A probably benign Het
Fbxw21 T C 9: 109,145,663 Y263C probably damaging Het
Fsip2 T A 2: 82,981,493 S2719T possibly damaging Het
Fv1 T C 4: 147,869,418 V147A probably benign Het
Gal T C 19: 3,411,590 E65G probably benign Het
Galnt6 T C 15: 100,716,178 T81A probably benign Het
Gcc2 A G 10: 58,270,439 E399G probably damaging Het
Gfi1b A T 2: 28,610,102 C306S probably damaging Het
Gm10654 T A 8: 70,931,852 noncoding transcript Het
Gm20388 A G 8: 123,080,604 probably benign Het
Gm4788 T G 1: 139,774,563 D61A probably damaging Het
Gm4953 T A 1: 159,168,359 noncoding transcript Het
Gorasp2 T C 2: 70,688,339 probably benign Het
Gse1 T C 8: 120,568,466 probably benign Het
H2-D1 A G 17: 35,265,997 E278G probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hgs T A 11: 120,477,202 S246T probably damaging Het
Hs2st1 T C 3: 144,465,082 T110A probably benign Het
Hydin A G 8: 110,595,438 Y4574C probably benign Het
Ighv1-23 C A 12: 114,764,752 V17F possibly damaging Het
Ighv8-14 A T 12: 115,808,565 noncoding transcript Het
Igsf21 C T 4: 140,034,623 R248H probably benign Het
Il23r T C 6: 67,423,561 N595S probably benign Het
Il5ra G T 6: 106,715,668 P372Q probably damaging Het
Iltifb T C 10: 118,294,989 M1V probably null Het
Inppl1 A G 7: 101,832,309 V222A possibly damaging Het
Ints10 T C 8: 68,827,312 V697A probably damaging Het
Isg15 T A 4: 156,199,760 T104S probably benign Het
Kif11 A G 19: 37,417,937 T983A probably benign Het
Kif3b A T 2: 153,317,292 K338* probably null Het
Kpna2 T A 11: 106,990,719 I362F probably damaging Het
Lama2 G A 10: 27,138,927 T1595M probably damaging Het
Lrrc36 A G 8: 105,426,935 T126A probably benign Het
Lrrk1 T A 7: 66,295,454 D604V probably damaging Het
Map7d1 T C 4: 126,236,691 K409E probably damaging Het
Mast2 T C 4: 116,353,057 T110A probably benign Het
Micall2 G A 5: 139,716,825 T221M probably damaging Het
Morc2b T A 17: 33,137,377 N474Y probably damaging Het
Myo1e T A 9: 70,343,096 M528K probably benign Het
Nlrp1c-ps G T 11: 71,260,369 noncoding transcript Het
Nostrin T C 2: 69,161,142 S160P possibly damaging Het
Nup133 T C 8: 123,927,131 R530G possibly damaging Het
Olfr452 T A 6: 42,790,204 L55H probably damaging Het
Olfr488 T C 7: 108,256,037 I34V possibly damaging Het
Olfr894 A G 9: 38,219,096 E91G probably damaging Het
Pabpc4l A T 3: 46,446,162 M349K possibly damaging Het
Pah G A 10: 87,570,267 G256S probably benign Het
Park2 G T 17: 10,840,472 probably benign Het
Pigk T C 3: 152,740,204 S151P probably damaging Het
Plcd4 A C 1: 74,564,413 T658P possibly damaging Het
Pld4 A T 12: 112,764,517 S178C probably benign Het
Polr1a G A 6: 71,909,229 E23K possibly damaging Het
Pomt1 T C 2: 32,241,679 S127P probably damaging Het
Pon2 A G 6: 5,269,029 V215A possibly damaging Het
Ppp3cb A T 14: 20,509,440 M416K probably damaging Het
Prdm1 A T 10: 44,442,052 N273K possibly damaging Het
Prg4 T A 1: 150,455,823 probably benign Het
Ptch1 G A 13: 63,523,052 T888M probably damaging Het
Pusl1 T G 4: 155,891,442 probably benign Het
Rif1 C T 2: 52,110,518 T1328I probably damaging Het
Rngtt T G 4: 33,500,292 probably null Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd1 A G 8: 83,998,989 probably benign Het
Scamp5 A T 9: 57,451,452 F14I probably damaging Het
Shank3 C T 15: 89,504,344 R380C probably damaging Het
Slc1a4 C A 11: 20,332,166 A103S probably damaging Het
Slc39a14 A G 14: 70,309,922 V325A probably benign Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Sval1 A G 6: 41,955,444 N76S probably benign Het
Synpo C T 18: 60,629,864 probably benign Het
Sytl5 C T X: 9,915,602 P181L possibly damaging Het
Tacc1 A G 8: 25,182,606 M111T possibly damaging Het
Tec T C 5: 72,756,351 D613G probably benign Het
Tecpr2 C T 12: 110,931,487 T391I possibly damaging Het
Thop1 G A 10: 81,073,291 G52D probably damaging Het
Tmco5 T A 2: 116,892,208 V270D possibly damaging Het
Ttn C T 2: 76,726,629 E28265K possibly damaging Het
Tuft1 T C 3: 94,635,443 D72G probably damaging Het
Tyrp1 C T 4: 80,850,907 probably benign Het
Usp9y T C Y: 1,308,041 D2265G probably damaging Het
Vmn2r104 G A 17: 20,030,026 A661V probably benign Het
Vwa5a A T 9: 38,737,972 N672I probably benign Het
Wdr95 A T 5: 149,611,692 K772* probably null Het
Ybx1 T C 4: 119,282,813 T106A probably benign Het
Ypel3 T C 7: 126,777,789 S14P probably benign Het
Zfp518a T A 19: 40,915,528 S1300R probably benign Het
Zscan5b A T 7: 6,239,190 *469Y probably null Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 intron probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 intron probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCGACGGTAAATATACATACAGT -3'
(R):5'- AGCACCAGGAAAACAGCAATTT -3'

Sequencing Primer
(F):5'- TTATTTGATAGCTCTATTGCCTGC -3'
(R):5'- TTAATCACCCCAACCAAGTATTCACG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R49110111_PCR_F: 5’- TGCGACGGTAAATATACATACAGT-3’

R49110111_PCR_R: 5’- AGCACCAGGAAAACAGCAATTT-3’

 

Sequencing Primers

R49110111_SEQ_F: 5’- TTATTTGATAGCTCTATTGCCTGC-3’
 

R49110111_SEQ_R: 5’- TTAATCACCCCAACCAAGTATTCACG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 569 nucleotides is amplified (Chr11: 54622050-54622618; NCBI RefSeq: NC_000077):

 

tgcgacggta aatatacata cagtttataa atttatatgt gtacacatat aacctactaa       

attaactggg tttttataaa atatttttat ttgatagctc tattgcctgc atatacatct      

gtgcatcata tgtgtgcaat gctatggagg tcagatatgg gtgtcaggtc ctacgttgat       

taacaagttg aatactgaat taacaaaatt tgtatgttaa agtaagcatc attgatcttt      

atactgggat ttgtgttttc ttacagaaca gttacttgag ttcatgcacc agctgcctgc      

ctttgcgaac atgaccatgt ctgtaaggag agaactctgc tccgtcatgg tttttgaagt      

agtagagcag gctggggctg ttattcttga agatgggcaa gaggtaggtc agcagattat      

taaattaatt tctctaagct tgtataaatt caagcttttt ggtttaaatt attttgcgtg      

aatacttggt tggggtgatt aatttttgaa gaggttgtct tgttgtggtt attgctttac      

tctttttaaa ttgctgtttt cctggtgct

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>T).

Posted On2016-11-02