Incidental Mutation 'R4911:Dnah1'
ID439489
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission 042513-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4911 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31295323 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1510 (Y1510C)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
Predicted Effect probably damaging
Transcript: ENSMUST00000048603
AA Change: Y1510C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: Y1510C

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228927
Meta Mutation Damage Score 0.514 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (149/153)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 132 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,170,939 probably null Het
4430402I18Rik G A 19: 28,897,503 probably benign Het
Aacs A G 5: 125,506,160 D260G possibly damaging Het
Aadacl4 T A 4: 144,613,792 L29H probably damaging Het
Abca7 T C 10: 80,012,188 probably null Het
Adgre1 G A 17: 57,447,832 M643I possibly damaging Het
Adgrl2 A T 3: 148,890,463 M79K probably damaging Het
Ankrd55 T A 13: 112,323,039 probably null Het
Arhgap21 A G 2: 20,858,989 I1257T probably damaging Het
Arhgap26 T A 18: 38,993,637 probably benign Het
Arhgap39 A G 15: 76,737,805 S199P probably damaging Het
Arhgef5 A G 6: 43,272,828 D171G probably benign Het
Atp7a T C X: 106,120,374 V1305A probably damaging Het
B3gnt3 T A 8: 71,692,934 R263S probably benign Het
B9d1 A C 11: 61,507,671 D59A probably benign Het
Bag2 A T 1: 33,748,276 I55N probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bbs2 A T 8: 94,089,115 D174E probably damaging Het
Bmp8b T C 4: 123,115,237 W203R probably damaging Het
Cacnb2 A T 2: 14,981,340 E359D possibly damaging Het
Camp T A 9: 109,847,583 probably null Het
Casp4 C T 9: 5,328,580 probably benign Het
Ccdc110 A T 8: 45,942,907 T612S probably benign Het
Cd209b T A 8: 3,926,640 probably null Het
Cemip T C 7: 83,983,253 D367G probably damaging Het
Cers5 T A 15: 99,747,079 N131I probably damaging Het
Chd5 T G 4: 152,360,672 V370G probably damaging Het
Cipc C A 12: 86,952,757 Q20K probably benign Het
Cnr2 T A 4: 135,917,201 F197I possibly damaging Het
Col7a1 G A 9: 108,975,219 G2233S unknown Het
Dcdc2b T A 4: 129,611,267 I125F possibly damaging Het
Ddi2 A G 4: 141,684,402 S400P probably benign Het
Ddx31 C A 2: 28,904,684 T664K probably benign Het
Dhx30 C A 9: 110,100,924 G35C probably damaging Het
Dmxl2 G A 9: 54,411,653 T1576I probably damaging Het
Dnah2 C T 11: 69,499,104 probably null Het
Dock10 C A 1: 80,606,236 G163C probably damaging Het
Edar T C 10: 58,621,324 N144S probably benign Het
Elavl2 T A 4: 91,308,678 E54D possibly damaging Het
Enam T G 5: 88,502,314 S561A probably benign Het
Ercc5 C A 1: 44,166,871 H315N possibly damaging Het
Esp31 A G 17: 38,644,661 E65G possibly damaging Het
Faap100 T C 11: 120,372,113 I806M probably benign Het
Fam159a T C 4: 108,377,461 T70A probably benign Het
Fbxw21 T C 9: 109,145,663 Y263C probably damaging Het
Fsip2 T A 2: 82,981,493 S2719T possibly damaging Het
Fv1 T C 4: 147,869,418 V147A probably benign Het
Gal T C 19: 3,411,590 E65G probably benign Het
Galnt6 T C 15: 100,716,178 T81A probably benign Het
Gcc2 A G 10: 58,270,439 E399G probably damaging Het
Gfi1b A T 2: 28,610,102 C306S probably damaging Het
Gm10654 T A 8: 70,931,852 noncoding transcript Het
Gm20388 A G 8: 123,080,604 probably benign Het
Gm4788 T G 1: 139,774,563 D61A probably damaging Het
Gm4953 T A 1: 159,168,359 noncoding transcript Het
Gorasp2 T C 2: 70,688,339 probably benign Het
Gse1 T C 8: 120,568,466 probably benign Het
H2-D1 A G 17: 35,265,997 E278G probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hgs T A 11: 120,477,202 S246T probably damaging Het
Hs2st1 T C 3: 144,465,082 T110A probably benign Het
Hydin A G 8: 110,595,438 Y4574C probably benign Het
Ighv1-23 C A 12: 114,764,752 V17F possibly damaging Het
Ighv8-14 A T 12: 115,808,565 noncoding transcript Het
Igsf21 C T 4: 140,034,623 R248H probably benign Het
Il23r T C 6: 67,423,561 N595S probably benign Het
Il5ra G T 6: 106,715,668 P372Q probably damaging Het
Iltifb T C 10: 118,294,989 M1V probably null Het
Inppl1 A G 7: 101,832,309 V222A possibly damaging Het
Ints10 T C 8: 68,827,312 V697A probably damaging Het
Isg15 T A 4: 156,199,760 T104S probably benign Het
Kif11 A G 19: 37,417,937 T983A probably benign Het
Kif3b A T 2: 153,317,292 K338* probably null Het
Kpna2 T A 11: 106,990,719 I362F probably damaging Het
Lama2 G A 10: 27,138,927 T1595M probably damaging Het
Lrrc36 A G 8: 105,426,935 T126A probably benign Het
Lrrk1 T A 7: 66,295,454 D604V probably damaging Het
Map7d1 T C 4: 126,236,691 K409E probably damaging Het
Mast2 T C 4: 116,353,057 T110A probably benign Het
Micall2 G A 5: 139,716,825 T221M probably damaging Het
Morc2b T A 17: 33,137,377 N474Y probably damaging Het
Myo1e T A 9: 70,343,096 M528K probably benign Het
Nlrp1c-ps G T 11: 71,260,369 noncoding transcript Het
Nostrin T C 2: 69,161,142 S160P possibly damaging Het
Nup133 T C 8: 123,927,131 R530G possibly damaging Het
Olfr452 T A 6: 42,790,204 L55H probably damaging Het
Olfr488 T C 7: 108,256,037 I34V possibly damaging Het
Olfr894 A G 9: 38,219,096 E91G probably damaging Het
Pabpc4l A T 3: 46,446,162 M349K possibly damaging Het
Pah G A 10: 87,570,267 G256S probably benign Het
Park2 G T 17: 10,840,472 probably benign Het
Pigk T C 3: 152,740,204 S151P probably damaging Het
Plcd4 A C 1: 74,564,413 T658P possibly damaging Het
Pld4 A T 12: 112,764,517 S178C probably benign Het
Polr1a G A 6: 71,909,229 E23K possibly damaging Het
Pomt1 T C 2: 32,241,679 S127P probably damaging Het
Pon2 A G 6: 5,269,029 V215A possibly damaging Het
Ppp3cb A T 14: 20,509,440 M416K probably damaging Het
Prdm1 A T 10: 44,442,052 N273K possibly damaging Het
Prg4 T A 1: 150,455,823 probably benign Het
Ptch1 G A 13: 63,523,052 T888M probably damaging Het
Pusl1 T G 4: 155,891,442 probably benign Het
Rapgef6 A T 11: 54,622,317 E122D probably damaging Het
Rif1 C T 2: 52,110,518 T1328I probably damaging Het
Rngtt T G 4: 33,500,292 probably null Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd1 A G 8: 83,998,989 probably benign Het
Scamp5 A T 9: 57,451,452 F14I probably damaging Het
Shank3 C T 15: 89,504,344 R380C probably damaging Het
Slc1a4 C A 11: 20,332,166 A103S probably damaging Het
Slc39a14 A G 14: 70,309,922 V325A probably benign Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Sval1 A G 6: 41,955,444 N76S probably benign Het
Synpo C T 18: 60,629,864 probably benign Het
Sytl5 C T X: 9,915,602 P181L possibly damaging Het
Tacc1 A G 8: 25,182,606 M111T possibly damaging Het
Tec T C 5: 72,756,351 D613G probably benign Het
Tecpr2 C T 12: 110,931,487 T391I possibly damaging Het
Thop1 G A 10: 81,073,291 G52D probably damaging Het
Tmco5 T A 2: 116,892,208 V270D possibly damaging Het
Ttn C T 2: 76,726,629 E28265K possibly damaging Het
Tuft1 T C 3: 94,635,443 D72G probably damaging Het
Tyrp1 C T 4: 80,850,907 probably benign Het
Usp9y T C Y: 1,308,041 D2265G probably damaging Het
Vmn2r104 G A 17: 20,030,026 A661V probably benign Het
Vwa5a A T 9: 38,737,972 N672I probably benign Het
Wdr95 A T 5: 149,611,692 K772* probably null Het
Ybx1 T C 4: 119,282,813 T106A probably benign Het
Ypel3 T C 7: 126,777,789 S14P probably benign Het
Zfp518a T A 19: 40,915,528 S1300R probably benign Het
Zscan5b A T 7: 6,239,190 *469Y probably null Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCCATTTTGAGTTTTGCTGAGC -3'
(R):5'- TTTGAGTGGATCTCGCAGCTC -3'

Sequencing Primer
(F):5'- GCTGAGCTTTGCTTATTGATCTATG -3'
(R):5'- ATCTCGCAGCTCAGGTGAG -3'
Posted On2016-11-02