Incidental Mutation 'R5616:Vmn1r42'
ID439531
Institutional Source Beutler Lab
Gene Symbol Vmn1r42
Ensembl Gene ENSMUSG00000068232
Gene Namevomeronasal 1 receptor 42
SynonymsV1ra6
MMRRC Submission 043159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5616 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location89842573-89876413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89845102 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 162 (I162V)
Ref Sequence ENSEMBL: ENSMUSP00000154442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089419] [ENSMUST00000226436] [ENSMUST00000227279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089419
AA Change: I162V

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086840
Gene: ENSMUSG00000068232
AA Change: I162V

DomainStartEndE-ValueType
Pfam:V1R 54 318 3.6e-132 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226436
AA Change: I162V

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227279
AA Change: I162V

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,772,360 D443E probably benign Het
Arhgef5 A G 6: 43,275,940 D1037G probably benign Het
B3glct T A 5: 149,729,934 L148* probably null Het
Cacna1e G A 1: 154,442,194 P1481S probably damaging Het
Cacna1h C A 17: 25,377,667 R117L probably damaging Het
Cct6b A T 11: 82,741,349 V271E probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Cul1 G A 6: 47,523,788 R707H probably damaging Het
Dcakd A G 11: 102,995,005 L191P possibly damaging Het
Dhx32 T C 7: 133,721,228 *612W probably null Het
Disp1 T A 1: 183,088,349 T836S probably benign Het
Dppa4 T A 16: 48,291,030 V126D probably damaging Het
Fam98b A G 2: 117,267,786 T246A possibly damaging Het
Fkbp4 A T 6: 128,433,554 V273E probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr31b A G 17: 13,051,944 Y113H probably damaging Het
Gpr33 T C 12: 52,023,594 I221V probably damaging Het
Klhl1 A G 14: 96,518,293 F9L probably benign Het
Larp4b T A 13: 9,158,659 N449K probably damaging Het
Loxhd1 T C 18: 77,404,951 S1363P probably damaging Het
Lrrc8a T C 2: 30,255,354 V60A probably benign Het
Matn3 A G 12: 8,948,195 H51R probably benign Het
Mtrf1 T C 14: 79,401,445 C6R possibly damaging Het
Myh6 T C 14: 54,956,581 S784G probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nipal3 T C 4: 135,452,404 Y401C probably benign Het
Pcdhb20 A G 18: 37,504,532 E37G probably damaging Het
Pelp1 G A 11: 70,394,862 P727S possibly damaging Het
Prkca T C 11: 107,978,343 D472G possibly damaging Het
Ptprg A G 14: 12,122,120 H328R probably benign Het
Rtl1 C T 12: 109,592,739 E889K unknown Het
Rubcn T C 16: 32,826,923 D715G possibly damaging Het
Snurf C T 7: 59,999,385 E15K possibly damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Srp72 T G 5: 76,987,934 L237R probably damaging Het
Syne3 T C 12: 104,955,678 E406G probably damaging Het
Tgm2 A G 2: 158,128,720 S340P probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Tsc22d1 T C 14: 76,416,217 probably benign Het
Tsc22d2 G T 3: 58,417,162 probably benign Het
Vmn2r59 A G 7: 42,058,767 probably null Het
Wnt3 T C 11: 103,812,770 probably null Het
Other mutations in Vmn1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02055:Vmn1r42 APN 6 89845589 utr 5 prime probably benign
IGL02151:Vmn1r42 APN 6 89845041 missense possibly damaging 0.90
IGL02158:Vmn1r42 APN 6 89845314 missense probably damaging 0.96
IGL02731:Vmn1r42 APN 6 89845425 missense probably benign 0.41
IGL02738:Vmn1r42 APN 6 89844648 missense possibly damaging 0.69
IGL02817:Vmn1r42 APN 6 89845536 missense probably damaging 1.00
volkan UTSW 6 89844967 missense probably benign 0.00
R1131:Vmn1r42 UTSW 6 89845569 missense possibly damaging 0.88
R1500:Vmn1r42 UTSW 6 89845501 missense probably benign 0.01
R1557:Vmn1r42 UTSW 6 89844751 missense possibly damaging 0.66
R1561:Vmn1r42 UTSW 6 89845381 missense probably damaging 0.99
R1574:Vmn1r42 UTSW 6 89845077 missense possibly damaging 0.62
R1574:Vmn1r42 UTSW 6 89845381 missense probably damaging 0.99
R1574:Vmn1r42 UTSW 6 89845077 missense possibly damaging 0.62
R1857:Vmn1r42 UTSW 6 89844615 missense probably benign 0.28
R1858:Vmn1r42 UTSW 6 89844615 missense probably benign 0.28
R1916:Vmn1r42 UTSW 6 89844967 missense probably benign 0.00
R2284:Vmn1r42 UTSW 6 89844699 missense probably benign 0.26
R2912:Vmn1r42 UTSW 6 89844706 missense probably benign
R4541:Vmn1r42 UTSW 6 89845551 missense probably benign
R5085:Vmn1r42 UTSW 6 89844616 missense probably benign 0.00
R5384:Vmn1r42 UTSW 6 89845384 missense probably damaging 1.00
R5647:Vmn1r42 UTSW 6 89845332 missense probably benign 0.43
R5867:Vmn1r42 UTSW 6 89844779 nonsense probably null
R6569:Vmn1r42 UTSW 6 89845443 missense probably damaging 1.00
R6852:Vmn1r42 UTSW 6 89844787 missense possibly damaging 0.71
R7054:Vmn1r42 UTSW 6 89845069 missense possibly damaging 0.90
R7399:Vmn1r42 UTSW 6 89845513 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCTTAAGAGGGCTACCATGTAC -3'
(R):5'- GGGCTGGGATGACATCATATG -3'

Sequencing Primer
(F):5'- AGGGCTACCATGTACCAATTAG -3'
(R):5'- GTAAATTCCTTGTGTACCTGTACAG -3'
Posted On2016-11-08