Incidental Mutation 'R0496:Dnah9'
ID43954
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Namedynein, axonemal, heavy chain 9
SynonymsD11Ertd686e, Dnahc9
MMRRC Submission 038692-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R0496 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location65831282-66168551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66075135 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1685 (M1685K)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
Predicted Effect probably null
Transcript: ENSMUST00000080665
AA Change: M1685K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: M1685K

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,244 K1065E probably damaging Het
4932438A13Rik A G 3: 36,987,635 T2721A probably damaging Het
4933402N03Rik T C 7: 131,146,131 N44S probably benign Het
Abca13 A G 11: 9,291,701 D1188G probably benign Het
Abcb11 C T 2: 69,277,884 probably benign Het
Abcc8 A T 7: 46,108,820 I1274N probably damaging Het
Adamtsl1 G A 4: 86,341,198 C827Y probably damaging Het
Agap3 T A 5: 24,501,243 V369E probably damaging Het
Ankrd13b G A 11: 77,473,041 R195C probably damaging Het
Ap3b1 A G 13: 94,472,938 probably benign Het
Arhgef40 A T 14: 52,004,907 probably benign Het
Atad5 A G 11: 80,100,356 I692V probably benign Het
Atp5b G T 10: 128,086,174 R310L possibly damaging Het
AY358078 A T 14: 51,803,532 M103L unknown Het
Bcl9l T G 9: 44,509,518 V1370G probably benign Het
Bglap3 T A 3: 88,369,137 Q38L probably damaging Het
Cd38 T C 5: 43,868,891 F6L probably damaging Het
Cela3a A C 4: 137,404,468 V138G probably damaging Het
Clvs1 T A 4: 9,424,241 I229N probably damaging Het
Cpne1 G A 2: 156,079,419 H16Y probably damaging Het
Ctc1 T C 11: 69,035,507 L1069P probably damaging Het
Ctgf G T 10: 24,597,515 M317I possibly damaging Het
Dgkd G A 1: 87,936,900 S996N probably null Het
Dnajb12 C T 10: 59,879,801 R42* probably null Het
Dock5 T C 14: 67,817,518 Q633R probably damaging Het
Dync2h1 A G 9: 7,155,180 M868T probably benign Het
Enpp1 G T 10: 24,672,052 H208Q probably benign Het
Epha7 T A 4: 28,821,292 D152E probably damaging Het
Fancd2 T C 6: 113,555,130 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gm10964 A T 3: 103,739,429 probably null Het
Gm7075 G T 10: 63,421,602 C46* probably null Het
Gpbar1 T C 1: 74,278,981 F128L probably benign Het
Gsx2 T A 5: 75,077,065 M226K probably benign Het
Gucd1 T C 10: 75,511,266 D50G possibly damaging Het
Has1 A G 17: 17,843,746 Y544H probably benign Het
Hc A T 2: 35,013,571 Y1024N probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ift122 T A 6: 115,905,902 H659Q probably benign Het
Itga2 T C 13: 114,853,899 Q902R probably benign Het
Itgb2l T C 16: 96,434,701 K181E possibly damaging Het
Jak3 A T 8: 71,682,397 H558L probably damaging Het
Kcnh8 A G 17: 52,725,858 T58A probably benign Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt33a C T 11: 100,012,329 probably benign Het
Magi2 A T 5: 20,661,359 probably benign Het
Map4 G A 9: 110,039,850 probably benign Het
Map4k4 T A 1: 40,006,822 S754T probably damaging Het
Mapk8ip3 A G 17: 24,914,450 probably benign Het
Mib1 A G 18: 10,804,773 S918G probably benign Het
Mipol1 T A 12: 57,457,177 V377D probably damaging Het
Mlh1 T C 9: 111,241,556 T364A probably benign Het
Mta1 C T 12: 113,131,321 Q400* probably null Het
Mthfd1l C G 10: 4,090,006 R806G probably benign Het
Myh13 C A 11: 67,348,815 N730K probably damaging Het
Myom1 A G 17: 71,084,306 K937E probably damaging Het
Naxd T C 8: 11,510,224 probably benign Het
Negr1 G T 3: 157,016,267 K159N probably damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1170 A T 2: 88,224,155 Y292* probably null Het
Olfr137 A G 17: 38,304,658 S268P probably damaging Het
Olfr397 T C 11: 73,964,880 S91P probably benign Het
Olfr584 T C 7: 103,085,590 I19T probably damaging Het
Olfr620 C T 7: 103,611,997 A119T probably benign Het
Pcsk6 G A 7: 65,927,249 S58N probably benign Het
Pdzrn3 G A 6: 101,150,570 T1045I possibly damaging Het
Pitrm1 T C 13: 6,568,714 L641P probably damaging Het
Pkd1l1 G T 11: 8,929,430 H474N probably damaging Het
Pltp A G 2: 164,852,461 probably benign Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Racgap1 A T 15: 99,639,832 probably benign Het
Rhbg A G 3: 88,254,498 V50A probably benign Het
Rnf135 G A 11: 80,183,950 V12M probably damaging Het
Rufy2 T C 10: 62,993,170 V117A probably damaging Het
Safb A G 17: 56,605,630 M866V probably benign Het
Slc35c2 G T 2: 165,280,815 T183K probably damaging Het
Slc39a7 A G 17: 34,029,538 L377P probably damaging Het
Slit1 G A 19: 41,608,311 probably benign Het
Spaca9 G A 2: 28,693,010 H133Y probably damaging Het
Spout1 A G 2: 30,174,971 F339S probably benign Het
St6gal2 A G 17: 55,482,014 I16M probably damaging Het
Stat2 T C 10: 128,276,509 M6T probably benign Het
Swt1 T A 1: 151,411,270 H157L probably benign Het
Syne2 A G 12: 76,038,940 N147D possibly damaging Het
Tmem2 A T 19: 21,797,345 N117I possibly damaging Het
Tmem222 A T 4: 133,277,591 M45K possibly damaging Het
Tmem30a T A 9: 79,777,285 H95L probably damaging Het
Tns3 A C 11: 8,547,262 probably benign Het
Trpm3 A G 19: 22,698,778 I103V probably benign Het
Ube2n T C 10: 95,541,344 F57S probably benign Het
Vil1 T C 1: 74,421,340 S219P possibly damaging Het
Wdfy4 A G 14: 33,140,738 probably benign Het
Wdr7 T C 18: 63,791,843 S966P probably benign Het
Wnt8a A G 18: 34,544,847 N103D probably damaging Het
Zfp523 G A 17: 28,200,445 E186K possibly damaging Het
Zfp791 A T 8: 85,109,980 D418E probably benign Het
Zscan20 A G 4: 128,591,889 V192A probably benign Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65841238 splice site probably benign
IGL00805:Dnah9 APN 11 65881695 missense probably benign 0.00
IGL00826:Dnah9 APN 11 65989942 missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65849980 missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 66072056 missense probably damaging 1.00
IGL01353:Dnah9 APN 11 66080571 missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66155459 missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65955717 missense probably benign 0.14
IGL01537:Dnah9 APN 11 65947680 missense probably benign
IGL01565:Dnah9 APN 11 66033829 missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66118830 missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65831615 nonsense probably null
IGL01625:Dnah9 APN 11 66044645 missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66118829 missense probably damaging 1.00
IGL01819:Dnah9 APN 11 66108126 missense probably benign 0.33
IGL01896:Dnah9 APN 11 66130666 missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 66075034 splice site probably benign
IGL01923:Dnah9 APN 11 66125235 splice site probably benign
IGL02059:Dnah9 APN 11 66072958 missense probably damaging 1.00
IGL02068:Dnah9 APN 11 66061045 missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66117492 missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65927700 missense probably damaging 1.00
IGL02264:Dnah9 APN 11 66080488 splice site probably benign
IGL02325:Dnah9 APN 11 65834217 missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66125153 missense probably benign
IGL02440:Dnah9 APN 11 65955246 missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65947618 nonsense probably null
IGL02496:Dnah9 APN 11 66029363 missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65927601 missense probably benign 0.02
IGL02718:Dnah9 APN 11 65886640 missense probably damaging 0.99
IGL02832:Dnah9 APN 11 66040346 missense probably damaging 1.00
IGL02851:Dnah9 APN 11 66037744 splice site probably benign
IGL02859:Dnah9 APN 11 65881619 splice site probably benign
IGL02864:Dnah9 APN 11 66061003 missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66118967 missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65855272 missense probably damaging 0.98
IGL02987:Dnah9 APN 11 65841273 missense probably benign 0.23
IGL03160:Dnah9 APN 11 66108054 missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65981241 missense probably benign 0.13
IGL03180:Dnah9 APN 11 65886639 missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65947542 missense probably damaging 1.00
IGL02837:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0070:Dnah9 UTSW 11 66160040 missense probably benign 0.10
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0180:Dnah9 UTSW 11 66147290 missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65895905 missense probably benign 0.30
R0230:Dnah9 UTSW 11 65855315 missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65911852 missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65911789 critical splice donor site probably null
R0288:Dnah9 UTSW 11 66025134 critical splice donor site probably null
R0309:Dnah9 UTSW 11 66026972 splice site probably benign
R0356:Dnah9 UTSW 11 66130562 critical splice donor site probably null
R0403:Dnah9 UTSW 11 66084789 missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 66108135 missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65918713 splice site probably benign
R0557:Dnah9 UTSW 11 66084666 missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65990489 missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66118877 missense probably benign 0.02
R0599:Dnah9 UTSW 11 65965689 missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65841333 missense probably damaging 1.00
R0666:Dnah9 UTSW 11 66085458 missense probably benign 0.01
R0715:Dnah9 UTSW 11 66081248 splice site probably benign
R0726:Dnah9 UTSW 11 65965681 missense probably damaging 1.00
R0737:Dnah9 UTSW 11 66107898 missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66155530 missense probably benign 0.30
R0792:Dnah9 UTSW 11 65896001 missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 66005176 missense probably benign 0.00
R0973:Dnah9 UTSW 11 66005837 unclassified probably null
R0974:Dnah9 UTSW 11 66005837 unclassified probably null
R1055:Dnah9 UTSW 11 66160011 missense probably damaging 1.00
R1081:Dnah9 UTSW 11 66084877 missense probably damaging 0.99
R1184:Dnah9 UTSW 11 66084612 critical splice donor site probably null
R1225:Dnah9 UTSW 11 65871060 missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65927588 missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65955747 missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65874132 missense probably benign 0.22
R1447:Dnah9 UTSW 11 66108482 missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65927786 missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1486:Dnah9 UTSW 11 65834272 missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65881761 missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66112330 missense probably benign
R1617:Dnah9 UTSW 11 65895921 missense probably damaging 1.00
R1623:Dnah9 UTSW 11 66037637 missense probably damaging 1.00
R1626:Dnah9 UTSW 11 66085267 missense probably benign 0.05
R1671:Dnah9 UTSW 11 65927963 missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65954824 nonsense probably null
R1701:Dnah9 UTSW 11 65911924 missense probably damaging 1.00
R1702:Dnah9 UTSW 11 66085195 missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65915154 missense probably benign 0.11
R1718:Dnah9 UTSW 11 66168079 missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65981222 missense probably benign 0.31
R1784:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66119594 critical splice donor site probably null
R1801:Dnah9 UTSW 11 65955297 missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65850061 missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66118841 missense probably benign 0.10
R1840:Dnah9 UTSW 11 65834198 nonsense probably null
R1847:Dnah9 UTSW 11 65834386 missense probably damaging 1.00
R1872:Dnah9 UTSW 11 66037490 missense probably benign 0.16
R1929:Dnah9 UTSW 11 65976398 missense probably benign 0.05
R1969:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65955338 missense probably benign 0.11
R2049:Dnah9 UTSW 11 66044683 missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66145435 missense probably benign 0.31
R2104:Dnah9 UTSW 11 66061124 missense probably damaging 1.00
R2109:Dnah9 UTSW 11 66037585 missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66117483 missense probably damaging 1.00
R2172:Dnah9 UTSW 11 66072779 missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65859499 missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2272:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2396:Dnah9 UTSW 11 66085158 missense probably benign 0.01
R2398:Dnah9 UTSW 11 65915203 missense probably damaging 1.00
R2418:Dnah9 UTSW 11 66095415 nonsense probably null
R2419:Dnah9 UTSW 11 66095415 nonsense probably null
R2510:Dnah9 UTSW 11 66005169 missense probably damaging 1.00
R2680:Dnah9 UTSW 11 66033925 missense probably benign 0.00
R2875:Dnah9 UTSW 11 66168461 missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66117588 missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3237:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3433:Dnah9 UTSW 11 66075112 missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66156908 nonsense probably null
R3820:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3821:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3822:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3861:Dnah9 UTSW 11 66052994 splice site probably benign
R3918:Dnah9 UTSW 11 65870974 missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65834464 missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66133635 missense probably benign 0.03
R4072:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4076:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4097:Dnah9 UTSW 11 65990459 missense probably damaging 1.00
R4409:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65981214 missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66118749 missense probably benign 0.00
R4434:Dnah9 UTSW 11 66108075 missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65881641 missense probably benign 0.07
R4452:Dnah9 UTSW 11 66027082 missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66147389 missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4590:Dnah9 UTSW 11 66040392 missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66168152 missense probably benign
R4655:Dnah9 UTSW 11 65955732 missense probably benign 0.00
R4667:Dnah9 UTSW 11 66155531 missense probably benign
R4718:Dnah9 UTSW 11 66085473 missense probably benign
R4720:Dnah9 UTSW 11 66076358 missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65927726 missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65874124 nonsense probably null
R4963:Dnah9 UTSW 11 66084611 splice site probably null
R5074:Dnah9 UTSW 11 65850040 missense probably damaging 1.00
R5230:Dnah9 UTSW 11 66084666 missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66112333 missense probably benign 0.34
R5364:Dnah9 UTSW 11 65881696 missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 66029354 missense probably damaging 1.00
R5386:Dnah9 UTSW 11 66029356 missense probably damaging 1.00
R5389:Dnah9 UTSW 11 66095314 nonsense probably null
R5541:Dnah9 UTSW 11 66145336 missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65881740 missense probably benign 0.00
R5576:Dnah9 UTSW 11 65834096 splice site probably null
R5648:Dnah9 UTSW 11 65927755 missense probably benign 0.00
R5653:Dnah9 UTSW 11 65849980 missense probably damaging 0.99
R5713:Dnah9 UTSW 11 66025223 missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65955239 missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66126601 missense probably benign 0.01
R5831:Dnah9 UTSW 11 66108121 missense probably benign 0.00
R5847:Dnah9 UTSW 11 66095240 frame shift probably null
R5870:Dnah9 UTSW 11 66085210 missense probably benign 0.01
R5902:Dnah9 UTSW 11 66025187 missense probably benign 0.08
R5918:Dnah9 UTSW 11 65834199 missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65834481 missense probably damaging 1.00
R6065:Dnah9 UTSW 11 65855338 missense probably benign 0.05
R6065:Dnah9 UTSW 11 66145397 missense possibly damaging 0.65
R6086:Dnah9 UTSW 11 65989915 missense probably damaging 0.99
R6086:Dnah9 UTSW 11 66085174 missense probably benign
R6102:Dnah9 UTSW 11 65990516 missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66147399 missense probably benign
R6154:Dnah9 UTSW 11 65855338 missense probably benign 0.00
R6262:Dnah9 UTSW 11 65881805 splice site probably null
R6265:Dnah9 UTSW 11 66168094 missense probably benign 0.04
R6290:Dnah9 UTSW 11 65841375 missense probably damaging 1.00
R6345:Dnah9 UTSW 11 66037693 missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65955248 missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66168281 missense probably benign 0.37
R6582:Dnah9 UTSW 11 66061097 missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65955366 missense probably damaging 1.00
R6800:Dnah9 UTSW 11 66072739 critical splice donor site probably null
R6812:Dnah9 UTSW 11 65981329 missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66117626 missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 66085149 missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 66076341 missense probably damaging 1.00
R6977:Dnah9 UTSW 11 66107909 missense probably benign 0.37
R7021:Dnah9 UTSW 11 65981231 missense probably benign
V3553:Dnah9 UTSW 11 65970076 missense probably damaging 1.00
X0027:Dnah9 UTSW 11 66085479 missense probably benign 0.07
X0028:Dnah9 UTSW 11 65990452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGCTCTCAGAGGTTGTTGGAAG -3'
(R):5'- TGCAAACCCAGCTAACCCCTTTATG -3'

Sequencing Primer
(F):5'- TCTCAGAGGTTGTTGGAAGAGAAAG -3'
(R):5'- TAGAAAAATGTCTGCCCTTGCC -3'
Posted On2013-05-29