Incidental Mutation 'R5618:1700028K03Rik'
List |< first << previous [record 77 of 32981] next >> last >|
ID439630
Institutional Source Beutler Lab
Gene Symbol 1700028K03Rik
Ensembl Gene ENSMUSG00000089798
Gene NameRIKEN cDNA 1700028K03 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5618 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location107534709-107551542 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 107548199 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 167 (W167*)
Ref Sequence ENSEMBL: ENSMUSP00000124574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058921] [ENSMUST00000078021] [ENSMUST00000082121] [ENSMUST00000100949] [ENSMUST00000124546] [ENSMUST00000159902] [ENSMUST00000160160]
Predicted Effect probably null
Transcript: ENSMUST00000058921
AA Change: W167*
SMART Domains Protein: ENSMUSP00000058373
Gene: ENSMUSG00000089798
AA Change: W167*

DomainStartEndE-ValueType
Pfam:DUF4580 12 173 1.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078021
SMART Domains Protein: ENSMUSP00000077168
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 5.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082121
SMART Domains Protein: ENSMUSP00000080766
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 3.5e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100949
SMART Domains Protein: ENSMUSP00000098509
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 404 1.1e-63 PFAM
Pfam:Kinetochor_Ybp2 402 499 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124546
SMART Domains Protein: ENSMUSP00000122129
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 95 6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137939
Predicted Effect probably benign
Transcript: ENSMUST00000143074
SMART Domains Protein: ENSMUSP00000122032
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159902
AA Change: W167*
SMART Domains Protein: ENSMUSP00000124574
Gene: ENSMUSG00000089798
AA Change: W167*

DomainStartEndE-ValueType
Pfam:DUF4580 10 177 1.4e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160160
SMART Domains Protein: ENSMUSP00000124398
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
Pfam:DUF4580 10 140 1.5e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163064
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 C T 2: 58,462,943 R335Q probably damaging Het
Atg7 A G 6: 114,673,699 D67G probably damaging Het
Avil T C 10: 127,010,577 F417S possibly damaging Het
AW551984 A T 9: 39,590,704 L702Q probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Bcl7a A T 5: 123,361,202 N95Y probably damaging Het
Cblb A G 16: 52,152,668 D454G possibly damaging Het
Cc2d2a A T 5: 43,729,907 Q1226H probably benign Het
Cct5 A G 15: 31,598,015 S13P possibly damaging Het
Clca1 C T 3: 145,004,977 E822K probably benign Het
Csgalnact2 A T 6: 118,126,316 D228E probably damaging Het
Defb12 A T 8: 19,114,798 M8K possibly damaging Het
Dysf A G 6: 84,106,824 D736G probably benign Het
Exog G T 9: 119,462,751 D365Y probably damaging Het
Fam222b T G 11: 78,154,240 V81G probably benign Het
Fam69b T C 2: 26,634,875 S96P probably damaging Het
Fbl A G 7: 28,178,986 E301G probably damaging Het
Fez1 A T 9: 36,843,932 N76Y probably damaging Het
Gm13103 A T 4: 143,850,693 E15V possibly damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
H2-Q4 T A 17: 35,379,925 F57Y probably damaging Het
Ift88 T C 14: 57,481,508 I650T possibly damaging Het
Kif1b A T 4: 149,269,889 D231E possibly damaging Het
Lig4 A T 8: 9,972,021 D586E probably benign Het
Mlc1 C A 15: 88,974,566 L126F probably damaging Het
Muc4 A G 16: 32,754,253 T1376A probably benign Het
Ncoa6 A T 2: 155,437,897 D66E possibly damaging Het
Olfr522 A G 7: 140,162,272 V226A probably damaging Het
Olfr907 C T 9: 38,498,740 Q24* probably null Het
Pard6a T C 8: 105,702,914 V168A probably damaging Het
Pmpcb A G 5: 21,742,788 N163S possibly damaging Het
Prdm2 C T 4: 143,133,537 C1061Y probably benign Het
Prkdc A G 16: 15,809,612 Y3378C probably damaging Het
Sema6a A T 18: 47,281,948 V425E probably damaging Het
Sema7a A T 9: 57,960,283 E439D possibly damaging Het
Serpinf1 T A 11: 75,410,184 T402S possibly damaging Het
Sf3a2 T C 10: 80,804,576 probably benign Het
Smchd1 A T 17: 71,455,727 D172E probably damaging Het
Spag5 T G 11: 78,304,080 I71S probably benign Het
Spata31d1d G A 13: 59,726,400 A1107V probably benign Het
Svep1 A C 4: 58,070,537 S2416R probably benign Het
Tbc1d9 A G 8: 83,242,592 Y503C probably damaging Het
Tlr9 A T 9: 106,224,739 I410F possibly damaging Het
Tmem87a C A 2: 120,369,306 L452F probably benign Het
Tmprss11d A T 5: 86,306,295 M217K probably benign Het
Ttc37 T A 13: 76,173,426 S1346T probably benign Het
Vmn2r80 T C 10: 79,148,921 Y36H probably benign Het
Vmn2r87 A T 10: 130,479,948 F83Y probably damaging Het
Vmp1 C T 11: 86,663,562 R75H probably benign Het
Wapl T A 14: 34,691,906 Y242N possibly damaging Het
Zfp473 T A 7: 44,741,732 D6V probably benign Het
Other mutations in 1700028K03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:1700028K03Rik APN 5 107543950 nonsense probably null
IGL02152:1700028K03Rik APN 5 107548117 missense probably benign 0.05
R0519:1700028K03Rik UTSW 5 107548201 missense probably benign 0.34
R2040:1700028K03Rik UTSW 5 107545741 missense probably benign
R2858:1700028K03Rik UTSW 5 107545801 missense probably benign 0.33
R6408:1700028K03Rik UTSW 5 107543992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCACATCCATGTCGAGAG -3'
(R):5'- AGGTCCAGTATATGCTAGGGTAG -3'

Sequencing Primer
(F):5'- CACATCCATGTCGAGAGATGTTTGC -3'
(R):5'- CACTGTGTTGTGCAGCTGC -3'
Posted On2016-11-08