Incidental Mutation 'R5618:Spata31d1d'
ID439659
Institutional Source Beutler Lab
Gene Symbol Spata31d1d
Ensembl Gene ENSMUSG00000043986
Gene Namespermatogenesis associated 31 subfamily D, member 1D
Synonyms
MMRRC Submission 043277-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5618 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59725925-59731752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59726400 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1107 (A1107V)
Ref Sequence ENSEMBL: ENSMUSP00000128200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052978]
Predicted Effect probably benign
Transcript: ENSMUST00000052978
AA Change: A1107V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000128200
Gene: ENSMUSG00000043986
AA Change: A1107V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:DUF4599 70 155 5.4e-28 PFAM
low complexity region 228 238 N/A INTRINSIC
low complexity region 284 298 N/A INTRINSIC
Pfam:FAM75 383 733 2.6e-93 PFAM
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1111 1129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224724
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik G A 5: 107,548,199 W167* probably null Het
Acvr1 C T 2: 58,462,943 R335Q probably damaging Het
Atg7 A G 6: 114,673,699 D67G probably damaging Het
Avil T C 10: 127,010,577 F417S possibly damaging Het
AW551984 A T 9: 39,590,704 L702Q probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Bcl7a A T 5: 123,361,202 N95Y probably damaging Het
Cblb A G 16: 52,152,668 D454G possibly damaging Het
Cc2d2a A T 5: 43,729,907 Q1226H probably benign Het
Cct5 A G 15: 31,598,015 S13P possibly damaging Het
Clca1 C T 3: 145,004,977 E822K probably benign Het
Csgalnact2 A T 6: 118,126,316 D228E probably damaging Het
Defb12 A T 8: 19,114,798 M8K possibly damaging Het
Dysf A G 6: 84,106,824 D736G probably benign Het
Exog G T 9: 119,462,751 D365Y probably damaging Het
Fam222b T G 11: 78,154,240 V81G probably benign Het
Fam69b T C 2: 26,634,875 S96P probably damaging Het
Fbl A G 7: 28,178,986 E301G probably damaging Het
Fez1 A T 9: 36,843,932 N76Y probably damaging Het
Gm13103 A T 4: 143,850,693 E15V possibly damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
H2-Q4 T A 17: 35,379,925 F57Y probably damaging Het
Ift88 T C 14: 57,481,508 I650T possibly damaging Het
Kif1b A T 4: 149,269,889 D231E possibly damaging Het
Lig4 A T 8: 9,972,021 D586E probably benign Het
Mlc1 C A 15: 88,974,566 L126F probably damaging Het
Muc4 A G 16: 32,754,253 T1376A probably benign Het
Ncoa6 A T 2: 155,437,897 D66E possibly damaging Het
Olfr522 A G 7: 140,162,272 V226A probably damaging Het
Olfr907 C T 9: 38,498,740 Q24* probably null Het
Pard6a T C 8: 105,702,914 V168A probably damaging Het
Pmpcb A G 5: 21,742,788 N163S possibly damaging Het
Prdm2 C T 4: 143,133,537 C1061Y probably benign Het
Prkdc A G 16: 15,809,612 Y3378C probably damaging Het
Sema6a A T 18: 47,281,948 V425E probably damaging Het
Sema7a A T 9: 57,960,283 E439D possibly damaging Het
Serpinf1 T A 11: 75,410,184 T402S possibly damaging Het
Sf3a2 T C 10: 80,804,576 probably benign Het
Smchd1 A T 17: 71,455,727 D172E probably damaging Het
Spag5 T G 11: 78,304,080 I71S probably benign Het
Svep1 A C 4: 58,070,537 S2416R probably benign Het
Tbc1d9 A G 8: 83,242,592 Y503C probably damaging Het
Tlr9 A T 9: 106,224,739 I410F possibly damaging Het
Tmem87a C A 2: 120,369,306 L452F probably benign Het
Tmprss11d A T 5: 86,306,295 M217K probably benign Het
Ttc37 T A 13: 76,173,426 S1346T probably benign Het
Vmn2r80 T C 10: 79,148,921 Y36H probably benign Het
Vmn2r87 A T 10: 130,479,948 F83Y probably damaging Het
Vmp1 C T 11: 86,663,562 R75H probably benign Het
Wapl T A 14: 34,691,906 Y242N possibly damaging Het
Zfp473 T A 7: 44,741,732 D6V probably benign Het
Other mutations in Spata31d1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Spata31d1d APN 13 59730215 splice site probably benign
IGL02399:Spata31d1d APN 13 59730140 splice site probably benign
IGL02531:Spata31d1d APN 13 59727934 missense possibly damaging 0.86
IGL02687:Spata31d1d APN 13 59727864 missense possibly damaging 0.71
IGL02815:Spata31d1d APN 13 59726864 missense possibly damaging 0.72
IGL02893:Spata31d1d APN 13 59725979 missense possibly damaging 0.72
IGL03037:Spata31d1d APN 13 59726133 missense possibly damaging 0.86
IGL02796:Spata31d1d UTSW 13 59728243 missense possibly damaging 0.93
R0612:Spata31d1d UTSW 13 59727973 missense probably benign 0.06
R1345:Spata31d1d UTSW 13 59726024 missense possibly damaging 0.72
R1572:Spata31d1d UTSW 13 59728191 missense probably benign 0.01
R1736:Spata31d1d UTSW 13 59726497 missense probably benign 0.02
R1750:Spata31d1d UTSW 13 59728695 missense probably benign 0.33
R1894:Spata31d1d UTSW 13 59728122 missense probably benign 0.09
R2202:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2203:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2204:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2913:Spata31d1d UTSW 13 59726955 missense possibly damaging 0.72
R3942:Spata31d1d UTSW 13 59727462 missense probably benign 0.18
R4513:Spata31d1d UTSW 13 59728554 missense probably benign 0.32
R4824:Spata31d1d UTSW 13 59729241 missense possibly damaging 0.86
R4959:Spata31d1d UTSW 13 59727288 missense probably damaging 1.00
R4970:Spata31d1d UTSW 13 59727520 missense probably benign 0.33
R5406:Spata31d1d UTSW 13 59728778 missense probably benign 0.33
R5688:Spata31d1d UTSW 13 59726508 missense probably damaging 0.98
R5741:Spata31d1d UTSW 13 59728686 missense possibly damaging 0.86
R5867:Spata31d1d UTSW 13 59727240 missense possibly damaging 0.53
R5930:Spata31d1d UTSW 13 59727015 missense probably benign
R6263:Spata31d1d UTSW 13 59725983 missense probably benign 0.18
R6267:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6296:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6597:Spata31d1d UTSW 13 59726057 missense probably benign 0.01
R6985:Spata31d1d UTSW 13 59731615 missense probably benign 0.00
R7032:Spata31d1d UTSW 13 59728232 missense probably benign
R7174:Spata31d1d UTSW 13 59728580 missense possibly damaging 0.72
R7322:Spata31d1d UTSW 13 59726976 missense probably benign
R7444:Spata31d1d UTSW 13 59727193 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AAAGCAGCGGCCTGATTGTG -3'
(R):5'- AGCATCACTTCAGGAAGCAGG -3'

Sequencing Primer
(F):5'- CCTGATTGTGGAACCTGGGAC -3'
(R):5'- GTGGCTTTCTCCTGACAGAAAATGC -3'
Posted On2016-11-08