Incidental Mutation 'R5619:Raph1'
ID439675
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene NameRas association (RalGDS/AF-6) and pleckstrin homology domains 1
SynonymsC730009O10Rik, Lpd, 9430025M21Rik, lamellipodin
MMRRC Submission 043278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location60482292-60567104 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 60490255 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
Predicted Effect probably benign
Transcript: ENSMUST00000027168
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: I616V
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: I616V

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188511
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60525947 missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60502863 missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60489267 intron probably benign
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0227:Raph1 UTSW 1 60525977 missense probably benign 0.00
R0387:Raph1 UTSW 1 60510496 intron probably benign
R0607:Raph1 UTSW 1 60525869 missense probably damaging 1.00
R1740:Raph1 UTSW 1 60519024 nonsense probably null
R2274:Raph1 UTSW 1 60498500 missense probably damaging 1.00
R3108:Raph1 UTSW 1 60493386 missense probably benign 0.01
R3977:Raph1 UTSW 1 60498523 missense probably benign 0.39
R4260:Raph1 UTSW 1 60502965 missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60502869 missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60503001 unclassified probably benign
R4782:Raph1 UTSW 1 60489114 missense probably damaging 1.00
R5027:Raph1 UTSW 1 60496277 missense probably damaging 1.00
R5037:Raph1 UTSW 1 60496222 splice site probably null
R5106:Raph1 UTSW 1 60533300 missense probably damaging 1.00
R5506:Raph1 UTSW 1 60493498 intron probably benign
R5510:Raph1 UTSW 1 60522946 unclassified probably benign
R5587:Raph1 UTSW 1 60498473 missense probably damaging 1.00
R5591:Raph1 UTSW 1 60501746 unclassified probably benign
R5776:Raph1 UTSW 1 60490156 intron probably benign
R5802:Raph1 UTSW 1 60488673 missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60525720 missense probably damaging 0.97
R7122:Raph1 UTSW 1 60525977 missense probably benign 0.10
R7219:Raph1 UTSW 1 60502873 missense unknown
R7251:Raph1 UTSW 1 60489868 missense unknown
R7254:Raph1 UTSW 1 60499608 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAAAGGAAGAGGCTGCATC -3'
(R):5'- GCATGTCCTGAATTCCTTGC -3'

Sequencing Primer
(F):5'- TGTTGGAGACTTAAACAGGGTCCC -3'
(R):5'- CTGTTTAGTTTCATGGAGCCAAAGC -3'
Posted On2016-11-08