Incidental Mutation 'R5619:4931423N10Rik'
List |< first << previous [record 81 of 9592] next >> last >|
ID439685
Institutional Source Beutler Lab
Gene Symbol 4931423N10Rik
Ensembl Gene ENSMUSG00000026774
Gene NameRIKEN cDNA 4931423N10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location23207476-23267129 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 23257005 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028113] [ENSMUST00000114505]
Predicted Effect probably null
Transcript: ENSMUST00000028113
SMART Domains Protein: ENSMUSP00000028113
Gene: ENSMUSG00000026774

DomainStartEndE-ValueType
Blast:ANK 62 92 7e-15 BLAST
ANK 96 125 6.71e-2 SMART
ANK 129 158 1.3e1 SMART
ANK 162 191 1.01e-5 SMART
ANK 195 224 2.88e-1 SMART
ANK 228 257 1.93e-2 SMART
ANK 261 290 1.09e3 SMART
low complexity region 341 352 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114505
SMART Domains Protein: ENSMUSP00000110150
Gene: ENSMUSG00000026774

DomainStartEndE-ValueType
Blast:ANK 62 92 4e-15 BLAST
ANK 96 125 6.71e-2 SMART
ANK 137 166 2.88e-1 SMART
ANK 170 199 1.93e-2 SMART
ANK 203 232 1.09e3 SMART
low complexity region 282 293 N/A INTRINSIC
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in 4931423N10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:4931423N10Rik APN 2 23230168 missense probably damaging 0.99
IGL02141:4931423N10Rik APN 2 23230200 missense probably damaging 1.00
IGL02377:4931423N10Rik APN 2 23212655 intron probably benign
IGL03328:4931423N10Rik APN 2 23212805 missense possibly damaging 0.71
R0467:4931423N10Rik UTSW 2 23212820 missense possibly damaging 0.85
R0723:4931423N10Rik UTSW 2 23256924 splice site probably benign
R1169:4931423N10Rik UTSW 2 23256982 missense possibly damaging 0.53
R1507:4931423N10Rik UTSW 2 23208074 missense probably damaging 0.98
R4965:4931423N10Rik UTSW 2 23245115 missense probably benign 0.40
R5198:4931423N10Rik UTSW 2 23212461 missense probably damaging 1.00
R5677:4931423N10Rik UTSW 2 23212718 missense probably damaging 0.98
R5715:4931423N10Rik UTSW 2 23207977 missense possibly damaging 0.86
R6123:4931423N10Rik UTSW 2 23230122 missense possibly damaging 0.93
R6263:4931423N10Rik UTSW 2 23266733 unclassified probably benign
R6858:4931423N10Rik UTSW 2 23212664 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GGGTAAGAAATGTCCACACTGG -3'
(R):5'- TAACACTGAATGGGCTGAGC -3'

Sequencing Primer
(F):5'- CACACTGGAGGGTAATAAGTTA -3'
(R):5'- AATGGGCTGAGCAGGTTGC -3'
Posted On2016-11-08