Incidental Mutation 'R5619:Akap9'
ID439698
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene NameA kinase (PRKA) anchor protein (yotiao) 9
SynonymsAKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
MMRRC Submission 043278-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location3928054-4081310 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 3954760 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000143365]
Predicted Effect probably benign
Transcript: ENSMUST00000044492
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140977
Predicted Effect probably benign
Transcript: ENSMUST00000143365
SMART Domains Protein: ENSMUSP00000117209
Gene: ENSMUSG00000040407

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Blast:HPT 144 215 9e-22 BLAST
low complexity region 255 267 N/A INTRINSIC
low complexity region 315 333 N/A INTRINSIC
coiled coil region 422 571 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198973
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
Wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 synonymous probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 unclassified probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 intron probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGACAGTTGTAACAGAGTGC -3'
(R):5'- TCCTAGGAATGCAACCAAGC -3'

Sequencing Primer
(F):5'- TTGTAACAGAGTGCAGAAATCCTG -3'
(R):5'- TCAGCCCTTCGGTCCCAAAG -3'
Posted On2016-11-08