Incidental Mutation 'R5619:Wdr1'
ID439701
Institutional Source Beutler Lab
Gene Symbol Wdr1
Ensembl Gene ENSMUSG00000005103
Gene NameWD repeat domain 1
SynonymsAip1, rede, D5Wsu185e
MMRRC Submission 043278-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38526813-38563221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38529536 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 568 (V568G)
Ref Sequence ENSEMBL: ENSMUSP00000005234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005234] [ENSMUST00000201260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005234
AA Change: V568G

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005234
Gene: ENSMUSG00000005103
AA Change: V568G

DomainStartEndE-ValueType
WD40 47 86 1.7e-2 SMART
WD40 91 134 5.52e0 SMART
WD40 135 175 3.69e-3 SMART
WD40 178 217 4.4e-10 SMART
WD40 220 262 1.74e-8 SMART
WD40 309 350 7.05e-9 SMART
WD40 354 392 6.9e-1 SMART
WD40 434 473 1.36e-1 SMART
WD40 478 517 7.8e-2 SMART
WD40 521 560 1.83e-7 SMART
WD40 564 603 3.71e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201059
Predicted Effect possibly damaging
Transcript: ENSMUST00000201260
AA Change: V295G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143937
Gene: ENSMUSG00000005103
AA Change: V295G

DomainStartEndE-ValueType
WD40 36 77 4.6e-11 SMART
WD40 81 119 4.5e-3 SMART
WD40 161 200 8.9e-4 SMART
WD40 205 244 4.9e-4 SMART
WD40 248 287 1.2e-9 SMART
WD40 291 330 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202496
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Severe loss of function at this locus causes embryonic lethality. Mice homozygous for a hypomorphic ENU-induced allele exhibit thrombocytopenia due to impaired megakaryocyte maturation and platelet shedding, and develop autoinflammatory disease associated with defects in neutrophil function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Wdr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Wdr1 APN 5 38535323 missense probably benign 0.00
IGL01071:Wdr1 APN 5 38530067 missense probably benign 0.14
IGL01293:Wdr1 APN 5 38529543 missense probably benign 0.00
IGL01347:Wdr1 APN 5 38545715 missense possibly damaging 0.77
IGL01532:Wdr1 APN 5 38535187 missense probably damaging 1.00
IGL02409:Wdr1 APN 5 38531110 missense probably benign 0.06
IGL02415:Wdr1 APN 5 38531110 missense probably damaging 1.00
IGL02543:Wdr1 APN 5 38545822 missense probably damaging 1.00
IGL02550:Wdr1 APN 5 38540863 missense probably damaging 1.00
IGL03093:Wdr1 APN 5 38561129 missense probably benign 0.01
IGL03183:Wdr1 APN 5 38533482 critical splice donor site probably null
R0724:Wdr1 UTSW 5 38540862 missense possibly damaging 0.87
R1509:Wdr1 UTSW 5 38540562 missense probably damaging 0.96
R1589:Wdr1 UTSW 5 38529972 missense probably benign 0.43
R3039:Wdr1 UTSW 5 38530085 missense possibly damaging 0.94
R3767:Wdr1 UTSW 5 38540539 missense probably damaging 1.00
R4833:Wdr1 UTSW 5 38547029 missense probably damaging 1.00
R5405:Wdr1 UTSW 5 38535200 missense probably benign 0.03
R5475:Wdr1 UTSW 5 38529588 missense probably damaging 1.00
R5476:Wdr1 UTSW 5 38529588 missense probably damaging 1.00
R5852:Wdr1 UTSW 5 38537175 missense probably benign 0.00
R5876:Wdr1 UTSW 5 38530023 missense probably benign 0.01
R6170:Wdr1 UTSW 5 38529671 critical splice acceptor site probably null
R6367:Wdr1 UTSW 5 38545846 missense possibly damaging 0.68
R6524:Wdr1 UTSW 5 38530063 missense probably benign 0.07
R6643:Wdr1 UTSW 5 38540178 missense probably damaging 1.00
R6838:Wdr1 UTSW 5 38530031 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATGTCTCAGGGTTCCTCTGC -3'
(R):5'- CTGTTACTTCAAGGGCTGGC -3'

Sequencing Primer
(F):5'- TGCAGGCCAGCAGAGTG -3'
(R):5'- ACATGGCGCTCTGGCCTTAG -3'
Posted On2016-11-08