Incidental Mutation 'R5619:Prkg2'
ID439702
Institutional Source Beutler Lab
Gene Symbol Prkg2
Ensembl Gene ENSMUSG00000029334
Gene Nameprotein kinase, cGMP-dependent, type II
SynonymsPrkgr2, cGK-II
MMRRC Submission 043278-MU
Accession Numbers

NCBI RefSeq: NM_008926.4; MGI: 108173

Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location98929773-99037351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98988297 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 301 (C301F)
Ref Sequence ENSEMBL: ENSMUSP00000031277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031277] [ENSMUST00000161490]
Predicted Effect probably damaging
Transcript: ENSMUST00000031277
AA Change: C301F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031277
Gene: ENSMUSG00000029334
AA Change: C301F

DomainStartEndE-ValueType
coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 424 682 9.46e-75 SMART
S_TK_X 683 733 9.83e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161490
AA Change: C301F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124963
Gene: ENSMUSG00000029334
AA Change: C301F

DomainStartEndE-ValueType
coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 453 711 1.19e-89 SMART
S_TK_X 712 762 9.83e-4 SMART
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
MGI Phenotype Strain: 24494704
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein plays a role in the regulation of fluid balance in the intestine. A similar protein in mouse is thought to regulate differentiation and proliferation of cells in the colon. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice exhibit dwarfism, with abnormal skull morphology and short limbs and vertebrae. Defects in axial organization of the growth plates was evident as mice aged. Digestive secretion in response to enterotoxin was reduced. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Prkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Prkg2 APN 5 99024541 missense probably benign 0.00
IGL01063:Prkg2 APN 5 98969936 critical splice donor site probably null
IGL02060:Prkg2 APN 5 99024515 missense probably benign 0.32
IGL02666:Prkg2 APN 5 98997519 splice site probably benign
IGL02992:Prkg2 APN 5 99024506 missense probably benign
IGL03040:Prkg2 APN 5 98973107 critical splice donor site probably null
P0005:Prkg2 UTSW 5 98969947 missense probably damaging 1.00
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0115:Prkg2 UTSW 5 98994655 splice site probably null
R0403:Prkg2 UTSW 5 98994645 missense possibly damaging 0.95
R0452:Prkg2 UTSW 5 98997520 splice site probably benign
R0481:Prkg2 UTSW 5 98994655 splice site probably null
R1194:Prkg2 UTSW 5 98971926 missense probably benign 0.00
R1534:Prkg2 UTSW 5 98994561 missense probably damaging 1.00
R1861:Prkg2 UTSW 5 98947416 missense probably damaging 1.00
R2010:Prkg2 UTSW 5 99024805 missense probably benign
R2031:Prkg2 UTSW 5 99024451 missense possibly damaging 0.85
R2176:Prkg2 UTSW 5 98966509 splice site probably benign
R3607:Prkg2 UTSW 5 98947377 missense probably damaging 1.00
R3958:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R3960:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R4012:Prkg2 UTSW 5 98979815 missense possibly damaging 0.93
R4794:Prkg2 UTSW 5 98966633 missense probably damaging 1.00
R4840:Prkg2 UTSW 5 98981143 missense probably benign 0.03
R4867:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5182:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5226:Prkg2 UTSW 5 98976462 missense possibly damaging 0.92
R5274:Prkg2 UTSW 5 98969991 missense probably damaging 1.00
R5416:Prkg2 UTSW 5 98943467 missense probably benign 0.05
R5531:Prkg2 UTSW 5 98967734 missense probably damaging 1.00
R6264:Prkg2 UTSW 5 98934364 missense probably benign 0.22
R6925:Prkg2 UTSW 5 98966510 critical splice donor site probably null
Z1088:Prkg2 UTSW 5 99024804 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTGTGAGCTGCCCTAAAAC -3'
(R):5'- GGGATACATGAACCATTTTCCATTG -3'

Sequencing Primer
(F):5'- TCACAACTGGACATGGCT -3'
(R):5'- AGCCTGGACTACATTGTGAGACTC -3'
Posted On2016-11-08