Incidental Mutation 'R5619:Tgfbr3'
ID439703
Institutional Source Beutler Lab
Gene Symbol Tgfbr3
Ensembl Gene ENSMUSG00000029287
Gene Nametransforming growth factor, beta receptor III
Synonymsbetaglycan, TBRIII, 1110036H20Rik
MMRRC Submission 043278-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107106570-107289629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107140514 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 427 (I427N)
Ref Sequence ENSEMBL: ENSMUSP00000031224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031224]
Predicted Effect probably benign
Transcript: ENSMUST00000031224
AA Change: I427N

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031224
Gene: ENSMUSG00000029287
AA Change: I427N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
internal_repeat_1 64 193 2.48e-5 PROSPERO
internal_repeat_1 232 361 2.48e-5 PROSPERO
low complexity region 419 430 N/A INTRINSIC
ZP 454 731 8.12e-65 SMART
transmembrane domain 786 808 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199780
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes the transforming growth factor (TGF)-beta type III receptor. The encoded receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die as embryos. The very few individuals that survive are poorly fertile with abnormalities of the spleen, liver, heart, and skeletal system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Tgfbr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Tgfbr3 APN 5 107142501 missense probably benign 0.00
IGL01135:Tgfbr3 APN 5 107215028 missense probably damaging 1.00
IGL01375:Tgfbr3 APN 5 107136971 missense probably benign
IGL01457:Tgfbr3 APN 5 107149898 missense probably damaging 1.00
IGL01599:Tgfbr3 APN 5 107118451 missense probably damaging 0.98
IGL01646:Tgfbr3 APN 5 107121413 splice site probably benign
IGL01945:Tgfbr3 APN 5 107121358 critical splice donor site probably null
IGL03039:Tgfbr3 APN 5 107177799 splice site probably benign
IGL03202:Tgfbr3 APN 5 107109764 splice site probably benign
IGL03378:Tgfbr3 APN 5 107109702 missense probably damaging 1.00
R0131:Tgfbr3 UTSW 5 107132816 missense probably benign 0.00
R0452:Tgfbr3 UTSW 5 107140423 missense probably benign 0.00
R0665:Tgfbr3 UTSW 5 107177850 missense probably benign 0.11
R0667:Tgfbr3 UTSW 5 107177850 missense probably benign 0.11
R0751:Tgfbr3 UTSW 5 107139883 missense probably damaging 1.00
R1373:Tgfbr3 UTSW 5 107214943 missense probably benign 0.01
R1777:Tgfbr3 UTSW 5 107136930 missense probably benign 0.31
R1887:Tgfbr3 UTSW 5 107137008 missense probably damaging 1.00
R3019:Tgfbr3 UTSW 5 107137546 missense possibly damaging 0.70
R3552:Tgfbr3 UTSW 5 107139839 missense probably damaging 0.99
R3617:Tgfbr3 UTSW 5 107140619 missense possibly damaging 0.65
R3901:Tgfbr3 UTSW 5 107214887 splice site probably benign
R4830:Tgfbr3 UTSW 5 107109719 missense probably damaging 1.00
R4939:Tgfbr3 UTSW 5 107130469 missense probably benign
R5020:Tgfbr3 UTSW 5 107214970 missense probably damaging 1.00
R5044:Tgfbr3 UTSW 5 107136929 missense possibly damaging 0.88
R5752:Tgfbr3 UTSW 5 107139807 missense probably benign 0.01
R5768:Tgfbr3 UTSW 5 107149895 missense probably benign
R5799:Tgfbr3 UTSW 5 107109608 utr 3 prime probably benign
R5818:Tgfbr3 UTSW 5 107133003 missense probably benign
R5846:Tgfbr3 UTSW 5 107140655 missense possibly damaging 0.51
R5859:Tgfbr3 UTSW 5 107140515 missense probably benign 0.00
R6049:Tgfbr3 UTSW 5 107118485 missense probably damaging 0.99
R6378:Tgfbr3 UTSW 5 107177813 missense probably benign 0.00
R6696:Tgfbr3 UTSW 5 107136930 missense probably benign 0.02
R6823:Tgfbr3 UTSW 5 107149914 missense probably damaging 1.00
R6994:Tgfbr3 UTSW 5 107133026 missense probably damaging 1.00
X0022:Tgfbr3 UTSW 5 107136926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAAGCTTCACGTCTTTC -3'
(R):5'- GTCACTCATGATGGCTTGCC -3'

Sequencing Primer
(F):5'- CCTTTAAGAGACTGCACTGACCTG -3'
(R):5'- CCTGTCTTTCCCAGAGGAGATGAG -3'
Posted On2016-11-08