Incidental Mutation 'R5619:Pkp3'
ID439714
Institutional Source Beutler Lab
Gene Symbol Pkp3
Ensembl Gene ENSMUSG00000054065
Gene Nameplakophilin 3
Synonyms
MMRRC Submission 043278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141078218-141090510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141088506 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 556 (L556P)
Ref Sequence ENSEMBL: ENSMUSP00000101654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066873] [ENSMUST00000097958] [ENSMUST00000106039] [ENSMUST00000209199] [ENSMUST00000209294] [ENSMUST00000210167]
Predicted Effect probably damaging
Transcript: ENSMUST00000066873
AA Change: L531P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069961
Gene: ENSMUSG00000054065
AA Change: L531P

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
ARM 350 390 8.11e-5 SMART
ARM 392 432 3.24e-4 SMART
ARM 489 536 3.85e0 SMART
internal_repeat_1 605 702 2.91e-9 PROSPERO
low complexity region 717 731 N/A INTRINSIC
low complexity region 757 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097958
SMART Domains Protein: ENSMUSP00000095571
Gene: ENSMUSG00000025494

DomainStartEndE-ValueType
IG 17 112 5.21e-2 SMART
transmembrane domain 117 139 N/A INTRINSIC
Pfam:TIR 163 327 2.2e-19 PFAM
Pfam:TIR_2 166 308 2.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106039
AA Change: L556P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101654
Gene: ENSMUSG00000054065
AA Change: L556P

DomainStartEndE-ValueType
low complexity region 65 79 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 204 219 N/A INTRINSIC
low complexity region 244 253 N/A INTRINSIC
ARM 375 415 8.11e-5 SMART
ARM 417 457 3.24e-4 SMART
ARM 514 561 3.85e0 SMART
internal_repeat_1 630 727 4.99e-9 PROSPERO
low complexity region 742 756 N/A INTRINSIC
low complexity region 782 799 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161142
Predicted Effect probably benign
Transcript: ENSMUST00000209199
Predicted Effect probably benign
Transcript: ENSMUST00000209294
Predicted Effect probably benign
Transcript: ENSMUST00000209887
Predicted Effect probably benign
Transcript: ENSMUST00000210167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210978
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may act in cellular desmosome-dependent adhesion and signaling pathways. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit retarded hair growth, epidermal thickening and abnormal hair follicles that lead to secondary alopecia and acute dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Pkp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pkp3 APN 7 141084182 nonsense probably null
IGL01367:Pkp3 APN 7 141084076 missense probably damaging 1.00
IGL01793:Pkp3 APN 7 141088904 missense probably benign 0.01
IGL02140:Pkp3 APN 7 141089336 missense probably damaging 1.00
IGL02231:Pkp3 APN 7 141084238 missense probably damaging 1.00
IGL02708:Pkp3 APN 7 141089768 unclassified probably benign
IGL02755:Pkp3 APN 7 141088405 splice site probably null
IGL03017:Pkp3 APN 7 141083370 missense probably benign 0.12
IGL03351:Pkp3 APN 7 141082693 missense probably benign
PIT4514001:Pkp3 UTSW 7 141089710 missense probably damaging 0.99
R0145:Pkp3 UTSW 7 141089763 critical splice donor site probably null
R0153:Pkp3 UTSW 7 141083343 missense probably damaging 1.00
R0184:Pkp3 UTSW 7 141088367 missense probably benign 0.41
R1014:Pkp3 UTSW 7 141082826 missense probably benign 0.03
R1664:Pkp3 UTSW 7 141087647 missense probably damaging 1.00
R1844:Pkp3 UTSW 7 141088502 missense probably damaging 1.00
R1891:Pkp3 UTSW 7 141084056 unclassified probably null
R2100:Pkp3 UTSW 7 141083292 missense probably damaging 1.00
R3772:Pkp3 UTSW 7 141082346 start codon destroyed probably null
R4003:Pkp3 UTSW 7 141088737 critical splice acceptor site probably null
R4089:Pkp3 UTSW 7 141084143 missense probably damaging 1.00
R4670:Pkp3 UTSW 7 141082699 missense probably benign 0.00
R5266:Pkp3 UTSW 7 141083277 missense probably damaging 1.00
R6113:Pkp3 UTSW 7 141082656 missense probably damaging 0.97
R6820:Pkp3 UTSW 7 141079844 critical splice donor site probably null
X0028:Pkp3 UTSW 7 141089948 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTAGTGGATGCTCTGGTCAC -3'
(R):5'- GAGTGCATCAGCTGTGAGAG -3'

Sequencing Primer
(F):5'- GATGCTCTGGTCACCTACATCAAC -3'
(R):5'- AGAGCATCAGTCTGGCACTTC -3'
Posted On2016-11-08