Incidental Mutation 'R5619:Ostm1'
ID439720
Institutional Source Beutler Lab
Gene Symbol Ostm1
Ensembl Gene ENSMUSG00000038280
Gene Nameosteopetrosis associated transmembrane protein 1
Synonymsgl, 1200002H13Rik, HSPC019
MMRRC Submission 043278-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location42583822-42702459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42679329 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 116 (C116S)
Ref Sequence ENSEMBL: ENSMUSP00000035516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040718] [ENSMUST00000105497] [ENSMUST00000144806]
Predicted Effect probably damaging
Transcript: ENSMUST00000040718
AA Change: C116S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035516
Gene: ENSMUSG00000038280
AA Change: C116S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 59 84 N/A INTRINSIC
Pfam:OSTMP1 88 332 1.9e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105497
SMART Domains Protein: ENSMUSP00000101136
Gene: ENSMUSG00000038280

DomainStartEndE-ValueType
Pfam:OSTMP1 1 171 1.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144806
SMART Domains Protein: ENSMUSP00000116534
Gene: ENSMUSG00000038280

DomainStartEndE-ValueType
Pfam:OSTMP1 1 169 4.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154048
Meta Mutation Damage Score 0.466 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in the degradation of G proteins via the ubiquitin-dependent proteasome pathway. The encoded protein binds to members of subfamily A of the regulator of the G-protein signaling (RGS) family through an N-terminal leucine-rich region. This protein also has a central RING finger-like domain and E3 ubiquitin ligase activity. This protein is highly conserved from flies to humans. Defects in this gene may cause the autosomal recessive, infantile malignant form of osteopetrosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: A model for osteopetrosis, mice homozygous for mutations of this gene display osteogenic abnormalities, including failure of tooth eruption. Mutants also have abnormal coat color as well as a reduced life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Ostm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01885:Ostm1 APN 10 42698151 missense possibly damaging 0.95
IGL02974:Ostm1 APN 10 42683162 missense probably damaging 1.00
IGL03195:Ostm1 APN 10 42698217 missense probably damaging 1.00
IGL03282:Ostm1 APN 10 42698231 missense probably damaging 1.00
IGL03385:Ostm1 APN 10 42698144 missense probably damaging 1.00
R0069:Ostm1 UTSW 10 42692956 missense probably benign 0.19
R0111:Ostm1 UTSW 10 42679258 missense probably damaging 1.00
R0480:Ostm1 UTSW 10 42696347 missense probably damaging 1.00
R4274:Ostm1 UTSW 10 42698234 missense probably damaging 1.00
R4433:Ostm1 UTSW 10 42679123 missense probably benign 0.21
R4731:Ostm1 UTSW 10 42678979 intron probably benign
R7140:Ostm1 UTSW 10 42683272 missense probably null 0.96
R7400:Ostm1 UTSW 10 42698217 missense probably damaging 1.00
U24488:Ostm1 UTSW 10 42679231 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GGACTTGACCCTGTCTTTGC -3'
(R):5'- AGAAGATGCCGGCTTACAG -3'

Sequencing Primer
(F):5'- GACCCTGTCTTTGCTGCAGG -3'
(R):5'- TCGGCTGATGTTGTCCAT -3'
Posted On2016-11-08