Incidental Mutation 'R5620:Arid2'
ID439813
Institutional Source Beutler Lab
Gene Symbol Arid2
Ensembl Gene ENSMUSG00000033237
Gene NameAT rich interactive domain 2 (ARID, RFX-like)
Synonyms4432409D24Rik, 1700124K17Rik, zipzap/p200
MMRRC Submission 043160-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5620 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location96287518-96404992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96372506 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1500 (T1500I)
Ref Sequence ENSEMBL: ENSMUSP00000093969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096250]
Predicted Effect probably benign
Transcript: ENSMUST00000096250
AA Change: T1500I

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: T1500I

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Pfam:RFX_DNA_binding 521 603 1.7e-26 PFAM
internal_repeat_1 767 843 3.29e-6 PROSPERO
low complexity region 902 942 N/A INTRINSIC
low complexity region 965 986 N/A INTRINSIC
low complexity region 1012 1054 N/A INTRINSIC
low complexity region 1118 1131 N/A INTRINSIC
internal_repeat_1 1132 1215 3.29e-6 PROSPERO
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1590 1614 N/A INTRINSIC
ZnF_C2H2 1626 1651 4.34e0 SMART
ZnF_C2H2 1659 1684 4.74e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176739
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,338,391 S511A probably benign Het
Abca3 C T 17: 24,396,470 T845I probably benign Het
Acaa2 G A 18: 74,805,874 A377T possibly damaging Het
Adcy4 C A 14: 55,772,367 E743* probably null Het
Ahnak T A 19: 9,013,094 L3914* probably null Het
Akap1 G T 11: 88,845,517 N106K possibly damaging Het
Arhgap8 A G 15: 84,756,369 S140G probably benign Het
Atp6v0a2 T A 5: 124,645,969 Y252* probably null Het
BC055324 C A 1: 163,962,044 G641* probably null Het
C4bp A G 1: 130,653,353 S140P probably damaging Het
Cald1 A G 6: 34,762,112 I384M probably damaging Het
Cdk12 A G 11: 98,210,983 I556V unknown Het
Chmp2a T C 7: 13,032,310 S174G probably benign Het
Clybl T A 14: 122,311,343 N52K probably damaging Het
Cyp4a29 C A 4: 115,250,891 S303R probably benign Het
Dab2 T A 15: 6,418,315 D59E probably damaging Het
Dag1 C A 9: 108,209,015 R309L probably damaging Het
Dync1i2 T A 2: 71,258,139 M505K probably benign Het
Eif2b1 A T 5: 124,579,012 M1K probably null Het
Epc1 A G 18: 6,448,917 S577P probably benign Het
Eps8l1 T A 7: 4,460,946 I23N possibly damaging Het
Etl4 A G 2: 20,530,226 E164G probably damaging Het
Gadl1 A T 9: 115,937,162 M1L probably benign Het
Gda T C 19: 21,397,544 D336G probably damaging Het
Grm2 A T 9: 106,650,446 V413D probably damaging Het
Hnrnpll G T 17: 80,038,622 N403K probably damaging Het
Ifit1 T A 19: 34,647,838 F125I probably damaging Het
Igkv5-43 C T 6: 69,823,908 V2I probably benign Het
Kat5 A C 19: 5,609,479 Y44* probably null Het
Klc2 A G 19: 5,112,856 V205A probably damaging Het
Klrb1c T A 6: 128,784,743 T133S possibly damaging Het
Krt20 A G 11: 99,435,457 L157P probably damaging Het
Krt26 G T 11: 99,337,771 T45N possibly damaging Het
Lama2 C T 10: 26,990,880 D2873N probably damaging Het
Lig1 T A 7: 13,286,606 C114S possibly damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Maml2 A T 9: 13,697,320 R21S probably damaging Het
Mrpl35 C T 6: 71,817,736 V83I probably benign Het
Myo3b A G 2: 70,238,910 R498G probably benign Het
Nup153 C A 13: 46,684,006 E1247* probably null Het
Olfr330 A T 11: 58,529,731 M85K probably damaging Het
Pcdhac2 A G 18: 37,144,204 N79S probably benign Het
Pcgf6 C T 19: 47,047,967 G221D probably damaging Het
Phf11b C T 14: 59,321,504 D260N probably benign Het
Pla2g5 T C 4: 138,804,610 M28V possibly damaging Het
Prpf8 T C 11: 75,505,101 S1934P possibly damaging Het
Prrc2c T C 1: 162,673,529 D1235G probably damaging Het
Rasgrp2 T C 19: 6,405,001 S254P probably damaging Het
Rassf8 C T 6: 145,820,181 probably benign Het
Rgs20 T A 1: 4,912,443 E167D probably damaging Het
Rmnd1 G T 10: 4,422,159 A180E probably damaging Het
Rnf103 A G 6: 71,510,008 D541G probably benign Het
Rpl9 G T 5: 65,389,125 Q140K probably benign Het
Sfmbt1 T G 14: 30,784,191 probably null Het
Shank1 C A 7: 44,312,736 D10E unknown Het
Srrm4 G T 5: 116,449,613 probably benign Het
Sucla2 T A 14: 73,595,396 V447E probably damaging Het
Tbc1d1 A G 5: 64,173,712 D78G probably benign Het
Tcp1 T A 17: 12,919,337 probably null Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Thsd7b G A 1: 130,162,936 probably null Het
Tmem63a A G 1: 180,970,246 M621V probably benign Het
Tnxb A T 17: 34,717,530 K2756* probably null Het
Trpm8 G A 1: 88,359,651 probably null Het
Txndc16 C A 14: 45,135,878 V764F possibly damaging Het
Ush2a A T 1: 188,759,823 D3103V possibly damaging Het
Usp22 A T 11: 61,158,380 I381N probably damaging Het
Zfp462 T A 4: 55,013,464 M1810K probably benign Het
Zfp64 T A 2: 168,899,968 M347L possibly damaging Het
Zfp69 T C 4: 120,930,522 D532G probably damaging Het
Other mutations in Arid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Arid2 APN 15 96372302 missense probably benign
IGL00321:Arid2 APN 15 96289089 missense probably damaging 0.97
IGL00434:Arid2 APN 15 96371300 missense probably damaging 0.99
IGL00576:Arid2 APN 15 96356758 missense probably damaging 0.99
IGL00766:Arid2 APN 15 96370405 missense probably benign 0.09
IGL01563:Arid2 APN 15 96372397 missense probably damaging 0.99
IGL01697:Arid2 APN 15 96361572 critical splice acceptor site probably null
IGL01845:Arid2 APN 15 96356797 missense probably damaging 1.00
IGL02159:Arid2 APN 15 96358912 splice site probably benign
IGL02341:Arid2 APN 15 96372185 missense probably benign
IGL02416:Arid2 APN 15 96350055 missense possibly damaging 0.63
IGL02578:Arid2 APN 15 96372235 missense probably benign 0.00
IGL02598:Arid2 APN 15 96371536 missense probably damaging 1.00
IGL02644:Arid2 APN 15 96368708 missense probably damaging 1.00
IGL02653:Arid2 APN 15 96287702 missense probably damaging 0.99
IGL03115:Arid2 APN 15 96370273 missense probably damaging 1.00
IGL03137:Arid2 APN 15 96371318 missense probably benign 0.44
IGL03220:Arid2 APN 15 96361772 missense probably damaging 0.99
IGL03249:Arid2 APN 15 96401965 missense probably damaging 1.00
IGL03256:Arid2 APN 15 96370762 missense probably benign 0.18
IGL03386:Arid2 APN 15 96361574 missense probably damaging 1.00
H8562:Arid2 UTSW 15 96369546 missense possibly damaging 0.77
I2288:Arid2 UTSW 15 96369511 missense possibly damaging 0.95
R0254:Arid2 UTSW 15 96370571 missense probably damaging 0.97
R0284:Arid2 UTSW 15 96378967 splice site probably benign
R0347:Arid2 UTSW 15 96370952 missense probably benign 0.01
R0366:Arid2 UTSW 15 96361720 splice site probably benign
R0400:Arid2 UTSW 15 96356925 unclassified probably benign
R0650:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R0651:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R1034:Arid2 UTSW 15 96369505 missense probably benign 0.01
R1615:Arid2 UTSW 15 96371654 missense possibly damaging 0.59
R1696:Arid2 UTSW 15 96370183 missense probably benign 0.01
R2024:Arid2 UTSW 15 96361799 missense probably damaging 1.00
R2046:Arid2 UTSW 15 96369387 missense probably damaging 1.00
R2069:Arid2 UTSW 15 96362590 missense probably damaging 1.00
R2149:Arid2 UTSW 15 96370835 missense probably damaging 1.00
R2300:Arid2 UTSW 15 96402006 missense probably damaging 1.00
R2336:Arid2 UTSW 15 96362549 missense probably damaging 1.00
R2359:Arid2 UTSW 15 96361878 missense probably damaging 1.00
R2368:Arid2 UTSW 15 96350012 missense possibly damaging 0.83
R2829:Arid2 UTSW 15 96369454 missense possibly damaging 0.95
R3013:Arid2 UTSW 15 96361936 missense probably damaging 1.00
R3109:Arid2 UTSW 15 96356746 missense probably damaging 1.00
R3765:Arid2 UTSW 15 96370714 missense probably benign 0.01
R3785:Arid2 UTSW 15 96372558 missense possibly damaging 0.83
R3811:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3812:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3813:Arid2 UTSW 15 96369950 missense probably benign 0.26
R3843:Arid2 UTSW 15 96351840 missense possibly damaging 0.86
R3978:Arid2 UTSW 15 96363622 missense probably damaging 1.00
R4279:Arid2 UTSW 15 96371756 missense probably damaging 1.00
R4569:Arid2 UTSW 15 96392462 missense probably damaging 1.00
R4597:Arid2 UTSW 15 96370856 missense probably damaging 1.00
R5020:Arid2 UTSW 15 96371988 missense probably damaging 0.96
R5154:Arid2 UTSW 15 96401985 missense probably damaging 1.00
R5303:Arid2 UTSW 15 96392468 missense probably damaging 1.00
R5766:Arid2 UTSW 15 96372205 missense probably benign 0.01
R6005:Arid2 UTSW 15 96370972 missense probably benign
R6169:Arid2 UTSW 15 96368677 missense probably benign 0.36
R6216:Arid2 UTSW 15 96356909 missense probably benign 0.18
R6392:Arid2 UTSW 15 96361602 missense probably damaging 0.99
R6430:Arid2 UTSW 15 96363694 missense probably benign
R6454:Arid2 UTSW 15 96372413 missense probably benign 0.20
R6672:Arid2 UTSW 15 96362345 missense probably benign 0.30
R6776:Arid2 UTSW 15 96370949 missense probably benign 0.00
R6985:Arid2 UTSW 15 96370148 missense probably benign 0.06
R7132:Arid2 UTSW 15 96350013 missense possibly damaging 0.67
R7133:Arid2 UTSW 15 96378875 missense probably damaging 0.99
R7453:Arid2 UTSW 15 96370724 missense probably benign
X0024:Arid2 UTSW 15 96372490 missense probably benign 0.00
X0066:Arid2 UTSW 15 96356804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCAAGAAGCCCCGAGTG -3'
(R):5'- TTCGCTACAGTGCTTGGGTC -3'

Sequencing Primer
(F):5'- GTACTGACCTGCCTAACGGAC -3'
(R):5'- TACAGTGCTTGGGTCCGCTC -3'
Posted On2016-11-08