Incidental Mutation 'R5631:Ap4m1'
List |< first << previous [record 55 of 958] next >> last >|
ID439849
Institutional Source Beutler Lab
Gene Symbol Ap4m1
Ensembl Gene ENSMUSG00000019518
Gene Nameadaptor-related protein complex AP-4, mu 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5631 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138172002-138180429 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 138174789 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 98 (*98W)
Ref Sequence ENSEMBL: ENSMUSP00000123770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019662] [ENSMUST00000048698] [ENSMUST00000110936] [ENSMUST00000110937] [ENSMUST00000139983] [ENSMUST00000143241] [ENSMUST00000147920] [ENSMUST00000148094] [ENSMUST00000148879] [ENSMUST00000151318] [ENSMUST00000153117] [ENSMUST00000153867] [ENSMUST00000155902]
Predicted Effect probably benign
Transcript: ENSMUST00000000505
SMART Domains Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 1e-41 BLAST
MCM 145 642 N/A SMART
AAA 373 526 2.9e-4 SMART
Blast:MCM 658 719 1e-32 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000019662
AA Change: R131G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019662
Gene: ENSMUSG00000019518
AA Change: R131G

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 142 2e-49 SMART
Pfam:Adap_comp_sub 173 449 2.5e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048698
SMART Domains Protein: ENSMUSP00000048016
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:DUF1546 308 399 1e-35 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 578 N/A INTRINSIC
low complexity region 586 602 N/A INTRINSIC
low complexity region 615 646 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110936
SMART Domains Protein: ENSMUSP00000106561
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:TAF6_C 308 397 1.1e-33 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 578 N/A INTRINSIC
low complexity region 586 602 N/A INTRINSIC
low complexity region 615 646 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110937
SMART Domains Protein: ENSMUSP00000106562
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:DUF1546 308 399 1.9e-36 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 549 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 606 615 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134100
Predicted Effect probably benign
Transcript: ENSMUST00000139983
SMART Domains Protein: ENSMUSP00000121446
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142687
Predicted Effect probably null
Transcript: ENSMUST00000143241
AA Change: *98W
SMART Domains Protein: ENSMUSP00000123770
Gene: ENSMUSG00000019518
AA Change: *98W

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 86 2e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147920
Predicted Effect probably benign
Transcript: ENSMUST00000148094
SMART Domains Protein: ENSMUSP00000121344
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 1 25 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148879
SMART Domains Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 6e-44 BLAST
MCM 145 389 1.77e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151318
AA Change: R145G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121338
Gene: ENSMUSG00000019518
AA Change: R145G

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 47 153 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153117
SMART Domains Protein: ENSMUSP00000138335
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153867
SMART Domains Protein: ENSMUSP00000121566
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 9.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155745
Predicted Effect probably benign
Transcript: ENSMUST00000155902
SMART Domains Protein: ENSMUSP00000120243
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157031
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric AP-4 complex. The encoded protein belongs to the adaptor complexes medium subunits family. This AP-4 complex is involved in the recognition and sorting of cargo proteins with tyrosine-based motifs from the trans-golgi network to the endosomal-lysosomal system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Ap4m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Ap4m1 APN 5 138172844 missense probably damaging 0.98
IGL03087:Ap4m1 APN 5 138174804 missense probably benign 0.01
R0227:Ap4m1 UTSW 5 138176276 unclassified probably benign
R0394:Ap4m1 UTSW 5 138172203 missense probably benign 0.32
R0639:Ap4m1 UTSW 5 138176239 missense probably benign 0.01
R4226:Ap4m1 UTSW 5 138172817 nonsense probably null
R4357:Ap4m1 UTSW 5 138173049 missense probably damaging 1.00
R5544:Ap4m1 UTSW 5 138178370 missense probably benign 0.15
R5585:Ap4m1 UTSW 5 138172240 missense probably damaging 1.00
R5691:Ap4m1 UTSW 5 138172391 missense probably damaging 1.00
R6504:Ap4m1 UTSW 5 138178096 missense probably benign
R6636:Ap4m1 UTSW 5 138172175 unclassified probably benign
R6637:Ap4m1 UTSW 5 138172175 unclassified probably benign
X0062:Ap4m1 UTSW 5 138178311 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGGCAAGCTCCCTTTGTTCC -3'
(R):5'- TGGGGCCACTTTATTCTGC -3'

Sequencing Primer
(F):5'- TCTCGTCTCTGAATGGGAGCAC -3'
(R):5'- GGGCCACTTTATTCTGCTGTGTC -3'
Posted On2016-11-08