Incidental Mutation 'R5631:Hpx'
ID439854
Institutional Source Beutler Lab
Gene Symbol Hpx
Ensembl Gene ENSMUSG00000030895
Gene Namehemopexin
SynonymsHpxn, hx
MMRRC Submission 043282-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5631 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105591613-105600137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105595601 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 126 (C126S)
Ref Sequence ENSEMBL: ENSMUSP00000147802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033185] [ENSMUST00000210531]
Predicted Effect probably damaging
Transcript: ENSMUST00000033185
AA Change: C187S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033185
Gene: ENSMUSG00000030895
AA Change: C187S

DomainStartEndE-ValueType
HX 56 93 1.29e0 SMART
HX 97 140 5.52e-8 SMART
Blast:HX 143 186 3e-7 BLAST
HX 187 230 3.48e-5 SMART
HX 261 304 1.07e-5 SMART
HX 306 351 5.49e-3 SMART
Blast:HX 358 403 2e-17 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000210531
AA Change: C126S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However, they have increased susceptiblity to induced hemolytic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Hpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Hpx APN 7 105591770 missense probably damaging 1.00
IGL01861:Hpx APN 7 105592186 nonsense probably null
IGL02441:Hpx APN 7 105592223 missense probably damaging 1.00
IGL03117:Hpx APN 7 105600071 missense possibly damaging 0.94
IGL03230:Hpx APN 7 105599312 missense probably benign 0.04
IGL03376:Hpx APN 7 105592251 unclassified probably benign
IGL03392:Hpx APN 7 105592402 missense probably damaging 1.00
PIT4520001:Hpx UTSW 7 105592134 missense probably benign 0.00
R0138:Hpx UTSW 7 105592238 missense probably damaging 1.00
R0364:Hpx UTSW 7 105596264 missense probably benign 0.18
R1195:Hpx UTSW 7 105599649 splice site probably benign
R1195:Hpx UTSW 7 105599649 splice site probably benign
R1958:Hpx UTSW 7 105596396 missense probably damaging 1.00
R2007:Hpx UTSW 7 105595574 missense probably damaging 1.00
R2025:Hpx UTSW 7 105595104 missense probably damaging 1.00
R2173:Hpx UTSW 7 105592083 missense probably benign 0.01
R2207:Hpx UTSW 7 105592426 missense probably damaging 1.00
R3162:Hpx UTSW 7 105599640 intron probably benign
R3849:Hpx UTSW 7 105596291 missense probably damaging 1.00
R4206:Hpx UTSW 7 105595147 missense probably null 0.01
R4510:Hpx UTSW 7 105592088 missense possibly damaging 0.94
R4511:Hpx UTSW 7 105592088 missense possibly damaging 0.94
R4709:Hpx UTSW 7 105600036 missense probably benign 0.05
R5029:Hpx UTSW 7 105591764 missense probably damaging 1.00
R5540:Hpx UTSW 7 105591912 missense possibly damaging 0.67
R5664:Hpx UTSW 7 105595148 missense probably benign 0.02
R5820:Hpx UTSW 7 105591788 missense possibly damaging 0.89
R5922:Hpx UTSW 7 105595624 missense probably damaging 1.00
R6707:Hpx UTSW 7 105595475 missense probably benign 0.09
R6714:Hpx UTSW 7 105595095 missense probably damaging 0.98
R7356:Hpx UTSW 7 105591710 missense probably damaging 0.99
X0066:Hpx UTSW 7 105596387 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AATTCCAGTGGATCCCAGGG -3'
(R):5'- ACCTTGCTGCAGGCTTTTG -3'

Sequencing Primer
(F):5'- CAGGGGCTGGGGATTTCTTACC -3'
(R):5'- AACTATGCTTCTTTGCTCCATGTAG -3'
Posted On2016-11-08