Incidental Mutation 'R5631:Zkscan3'
ID439871
Institutional Source Beutler Lab
Gene Symbol Zkscan3
Ensembl Gene ENSMUSG00000021327
Gene Namezinc finger with KRAB and SCAN domains 3
SynonymsZfp306, 2810435N07Rik, Zfp307, Skz1
MMRRC Submission 043282-MU
Accession Numbers

Genbank: NM_001145778, NM_023685; MGI: 1919989

Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5631 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21387003-21402755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21394533 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 176 (L176P)
Ref Sequence ENSEMBL: ENSMUSP00000153231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070785] [ENSMUST00000116433] [ENSMUST00000116434] [ENSMUST00000117721] [ENSMUST00000223831] [ENSMUST00000224820]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070785
AA Change: L205P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068424
Gene: ENSMUSG00000021327
AA Change: L205P

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 4.07e-6 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 1.38e-3 SMART
ZnF_C2H2 369 391 9.88e-5 SMART
ZnF_C2H2 397 419 1.95e-3 SMART
ZnF_C2H2 425 447 3.95e-4 SMART
ZnF_C2H2 479 501 5.21e-4 SMART
ZnF_C2H2 507 529 1.2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116433
AA Change: L205P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112134
Gene: ENSMUSG00000021327
AA Change: L205P

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116434
AA Change: L205P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112135
Gene: ENSMUSG00000021327
AA Change: L205P

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 4.07e-6 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 1.38e-3 SMART
ZnF_C2H2 369 391 9.88e-5 SMART
ZnF_C2H2 397 419 1.95e-3 SMART
ZnF_C2H2 425 447 3.95e-4 SMART
ZnF_C2H2 479 501 5.21e-4 SMART
ZnF_C2H2 507 529 1.2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117721
AA Change: L205P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112862
Gene: ENSMUSG00000021327
AA Change: L205P

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 256 3.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184464
Predicted Effect probably benign
Transcript: ENSMUST00000223831
AA Change: L38P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably damaging
Transcript: ENSMUST00000224820
AA Change: L176P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Other mutations in Zkscan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Zkscan3 APN 13 21394091 splice site probably benign
IGL02406:Zkscan3 APN 13 21388178 missense possibly damaging 0.71
IGL02725:Zkscan3 APN 13 21394893 missense possibly damaging 0.85
IGL02741:Zkscan3 APN 13 21393994 missense probably benign 0.05
3-1:Zkscan3 UTSW 13 21387881 missense probably benign 0.32
R0040:Zkscan3 UTSW 13 21394920 splice site probably null
R0040:Zkscan3 UTSW 13 21394920 splice site probably null
R0133:Zkscan3 UTSW 13 21394774 missense possibly damaging 0.73
R0660:Zkscan3 UTSW 13 21388460 missense probably damaging 1.00
R0737:Zkscan3 UTSW 13 21388596 missense probably benign
R1250:Zkscan3 UTSW 13 21388524 missense probably benign 0.32
R1671:Zkscan3 UTSW 13 21396135 missense possibly damaging 0.93
R1926:Zkscan3 UTSW 13 21396446 missense possibly damaging 0.88
R2899:Zkscan3 UTSW 13 21393973 missense probably damaging 1.00
R4119:Zkscan3 UTSW 13 21393949 missense possibly damaging 0.65
R4120:Zkscan3 UTSW 13 21393949 missense possibly damaging 0.65
R4606:Zkscan3 UTSW 13 21393783 missense probably benign 0.00
R5459:Zkscan3 UTSW 13 21394812 missense probably damaging 0.96
R5549:Zkscan3 UTSW 13 21394063 missense probably damaging 1.00
R5988:Zkscan3 UTSW 13 21396291 missense probably damaging 1.00
R6495:Zkscan3 UTSW 13 21387905 missense probably damaging 0.97
R7286:Zkscan3 UTSW 13 21394813 missense probably benign
R7363:Zkscan3 UTSW 13 21387822 missense probably damaging 0.99
R7443:Zkscan3 UTSW 13 21388438 nonsense probably null
Z1088:Zkscan3 UTSW 13 21388565 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CCCAAATGGTGAGACCTCAAG -3'
(R):5'- TGCCCTCAGAAGTCAGAGGTTAG -3'

Sequencing Primer
(F):5'- ACAACTGTCTGTAGCTGCAG -3'
(R):5'- CCTCAGAAGTCAGAGGTTAGTATTAC -3'
Posted On2016-11-08