Incidental Mutation 'R5632:Wee1'
ID439921
Institutional Source Beutler Lab
Gene Symbol Wee1
Ensembl Gene ENSMUSG00000031016
Gene NameWEE 1 homolog 1 (S. pombe)
SynonymsWee1A
MMRRC Submission 043283-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5632 (G1)
Quality Score165
Status Not validated
Chromosome7
Chromosomal Location110122046-110143286 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCCC to TCCC at 110124569 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033326]
Predicted Effect probably null
Transcript: ENSMUST00000033326
SMART Domains Protein: ENSMUSP00000033326
Gene: ENSMUSG00000031016

DomainStartEndE-ValueType
low complexity region 62 112 N/A INTRINSIC
Pfam:Pkinase_Tyr 298 566 1.9e-26 PFAM
Pfam:Pkinase 298 568 1.7e-61 PFAM
low complexity region 620 631 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210940
Meta Mutation Damage Score 0.5688 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is a tyrosine kinase belonging to the Ser/Thr family of protein kinases. This protein catalyzes the inhibitory tyrosine phosphorylation of CDC2/cyclin B kinase, and appears to coordinate the transition between DNA replication and mitosis by protecting the nucleus from cytoplasmically activated CDC2 kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. Mice homozygous for a knock-out allele exhibit lethality between E3.5 and E7.5 with reduced proliferation, increased apoptosis and abnormal G2/M checkpoint function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,171,583 F72L possibly damaging Het
Abcd4 T C 12: 84,617,302 T7A probably benign Het
Adam33 T G 2: 131,053,442 D619A probably damaging Het
Aldh3b3 C T 19: 3,968,522 probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Arhgef40 C A 14: 51,994,338 T727K probably damaging Het
Arrdc1 T C 2: 24,927,828 T43A probably benign Het
Bcl2l15 A G 3: 103,836,062 N93S probably benign Het
Cd5l G T 3: 87,366,107 E128* probably null Het
Cep97 T C 16: 55,915,583 D284G probably benign Het
Ckmt1 T A 2: 121,360,592 S162T probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cpeb4 A G 11: 31,889,877 D53G probably damaging Het
Crocc2 T A 1: 93,217,853 S1485R probably damaging Het
Dcaf5 G A 12: 80,397,752 A189V probably damaging Het
Duox2 C T 2: 122,281,455 G1355S probably damaging Het
Fam120b C T 17: 15,403,082 P441S probably benign Het
Fbxo41 A G 6: 85,484,504 L74P probably damaging Het
Gm996 T C 2: 25,579,264 T212A probably benign Het
H2-DMa A G 17: 34,138,001 T158A probably benign Het
Hcar2 T A 5: 123,864,469 T324S probably benign Het
Hif3a T C 7: 17,050,655 I222V possibly damaging Het
Ighv1-7 A G 12: 114,538,881 probably benign Het
Il20 T C 1: 130,907,428 E151G probably benign Het
Jarid2 A G 13: 44,896,290 E236G probably damaging Het
Knl1 T C 2: 119,070,352 S845P probably damaging Het
Lamc2 T C 1: 153,131,890 Y846C probably damaging Het
Lrp5 A G 19: 3,622,512 V599A probably benign Het
Lrrc8b T A 5: 105,480,297 S170T possibly damaging Het
Mex3d T C 10: 80,382,594 K263R probably damaging Het
Mtor A G 4: 148,469,006 K784E possibly damaging Het
Naip5 C A 13: 100,230,662 probably null Het
Ncor1 T C 11: 62,338,234 T609A possibly damaging Het
Ndufs1 C T 1: 63,150,059 A536T probably benign Het
Neto1 A G 18: 86,498,643 I362V probably benign Het
Nfatc3 T C 8: 106,079,057 L178P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nsd3 C T 8: 25,679,969 T707M probably benign Het
Olfr1013 T C 2: 85,770,269 V156A probably benign Het
Olfr1133 A T 2: 87,645,229 V298E probably damaging Het
Olfr568 A C 7: 102,877,797 S226R probably benign Het
Pcnx T A 12: 81,917,730 S224T probably damaging Het
Peak1 T C 9: 56,257,774 T957A probably damaging Het
Pex7 A T 10: 19,888,737 D153E probably damaging Het
Plscr1 A G 9: 92,266,424 E139G probably damaging Het
Psmb8 T C 17: 34,201,240 Y269H probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sft2d2 T C 1: 165,185,088 T80A probably damaging Het
Slc12a5 A G 2: 164,987,221 I583M possibly damaging Het
Slc23a4 T C 6: 34,957,022 M49V probably benign Het
Smarcb1 G A 10: 75,904,418 Q309* probably null Het
Sphkap A T 1: 83,278,285 V294E probably benign Het
Stoml1 C A 9: 58,253,370 P35Q probably damaging Het
Timm10b G C 7: 105,641,122 R42P probably damaging Het
Tnfrsf8 A T 4: 145,292,633 S211T possibly damaging Het
Ttn T C 2: 76,705,820 T26738A probably damaging Het
Vps13d A T 4: 145,074,882 Y474N probably damaging Het
Wdr81 A T 11: 75,445,906 F1552L probably damaging Het
Wnt7a A C 6: 91,394,655 Y108* probably null Het
Zfp512b C T 2: 181,585,668 R56K probably benign Het
Other mutations in Wee1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Wee1 APN 7 110134853 splice site probably null
IGL00981:Wee1 APN 7 110139669 missense probably damaging 1.00
IGL01017:Wee1 APN 7 110125848 missense possibly damaging 0.93
IGL01357:Wee1 APN 7 110142035 missense probably benign 0.39
IGL01838:Wee1 APN 7 110124537 missense probably benign 0.01
IGL01970:Wee1 APN 7 110139250 missense probably damaging 1.00
IGL02396:Wee1 APN 7 110142093 missense probably damaging 1.00
IGL02511:Wee1 APN 7 110139276 missense possibly damaging 0.55
IGL02884:Wee1 APN 7 110126062 missense probably benign 0.02
IGL03085:Wee1 APN 7 110124598 missense probably damaging 1.00
IGL03221:Wee1 APN 7 110126817 missense probably damaging 1.00
IGL03383:Wee1 APN 7 110139692 missense probably damaging 1.00
R0220:Wee1 UTSW 7 110124526 missense probably benign 0.10
R1934:Wee1 UTSW 7 110122491 missense probably benign 0.06
R3110:Wee1 UTSW 7 110130836 missense probably damaging 1.00
R3112:Wee1 UTSW 7 110130836 missense probably damaging 1.00
R3978:Wee1 UTSW 7 110124555 missense probably damaging 1.00
R4348:Wee1 UTSW 7 110130958 missense probably damaging 1.00
R5434:Wee1 UTSW 7 110124569 frame shift probably null
R5435:Wee1 UTSW 7 110124569 frame shift probably null
R5436:Wee1 UTSW 7 110124569 frame shift probably null
R5449:Wee1 UTSW 7 110124569 frame shift probably null
R5566:Wee1 UTSW 7 110126050 nonsense probably null
R5630:Wee1 UTSW 7 110124569 frame shift probably null
R5685:Wee1 UTSW 7 110124569 frame shift probably null
R5694:Wee1 UTSW 7 110124569 frame shift probably null
R5807:Wee1 UTSW 7 110124569 frame shift probably null
R5941:Wee1 UTSW 7 110124569 frame shift probably null
R6044:Wee1 UTSW 7 110139306 missense probably benign 0.00
R6163:Wee1 UTSW 7 110135651 missense probably damaging 1.00
R6826:Wee1 UTSW 7 110124663 critical splice donor site probably null
R7203:Wee1 UTSW 7 110134794 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACTTAGGAAGGCAAGTTGG -3'
(R):5'- GCCATTCAGTAGAAACCTAATTGTG -3'

Sequencing Primer
(F):5'- GTTGGAGGTTATATAGAGAAGACTCC -3'
(R):5'- AACCTAATTGTGTGCCAGGC -3'
Posted On2016-11-08