Incidental Mutation 'R5632:Arhgef40'
ID439942
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene NameRho guanine nucleotide exchange factor (GEF) 40
SynonymsE130112L23Rik
MMRRC Submission 043283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5632 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51984719-52006251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 51994338 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 727 (T727K)
Ref Sequence ENSEMBL: ENSMUSP00000138797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
Predicted Effect probably damaging
Transcript: ENSMUST00000093813
AA Change: T727K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: T727K

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100639
AA Change: T727K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: T727K

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182019
Predicted Effect probably damaging
Transcript: ENSMUST00000182061
AA Change: T727K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: T727K

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182412
AA Change: T24K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182740
Predicted Effect probably damaging
Transcript: ENSMUST00000182760
AA Change: T736K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: T736K

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182905
AA Change: T727K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562
AA Change: T727K

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000182909
AA Change: T727K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: T727K

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183167
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,171,583 F72L possibly damaging Het
Abcd4 T C 12: 84,617,302 T7A probably benign Het
Adam33 T G 2: 131,053,442 D619A probably damaging Het
Aldh3b3 C T 19: 3,968,522 probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Arrdc1 T C 2: 24,927,828 T43A probably benign Het
Bcl2l15 A G 3: 103,836,062 N93S probably benign Het
Cd5l G T 3: 87,366,107 E128* probably null Het
Cep97 T C 16: 55,915,583 D284G probably benign Het
Ckmt1 T A 2: 121,360,592 S162T probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cpeb4 A G 11: 31,889,877 D53G probably damaging Het
Crocc2 T A 1: 93,217,853 S1485R probably damaging Het
Dcaf5 G A 12: 80,397,752 A189V probably damaging Het
Duox2 C T 2: 122,281,455 G1355S probably damaging Het
Fam120b C T 17: 15,403,082 P441S probably benign Het
Fbxo41 A G 6: 85,484,504 L74P probably damaging Het
Gm996 T C 2: 25,579,264 T212A probably benign Het
H2-DMa A G 17: 34,138,001 T158A probably benign Het
Hcar2 T A 5: 123,864,469 T324S probably benign Het
Hif3a T C 7: 17,050,655 I222V possibly damaging Het
Ighv1-7 A G 12: 114,538,881 probably benign Het
Il20 T C 1: 130,907,428 E151G probably benign Het
Jarid2 A G 13: 44,896,290 E236G probably damaging Het
Knl1 T C 2: 119,070,352 S845P probably damaging Het
Lamc2 T C 1: 153,131,890 Y846C probably damaging Het
Lrp5 A G 19: 3,622,512 V599A probably benign Het
Lrrc8b T A 5: 105,480,297 S170T possibly damaging Het
Mex3d T C 10: 80,382,594 K263R probably damaging Het
Mtor A G 4: 148,469,006 K784E possibly damaging Het
Naip5 C A 13: 100,230,662 probably null Het
Ncor1 T C 11: 62,338,234 T609A possibly damaging Het
Ndufs1 C T 1: 63,150,059 A536T probably benign Het
Neto1 A G 18: 86,498,643 I362V probably benign Het
Nfatc3 T C 8: 106,079,057 L178P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nsd3 C T 8: 25,679,969 T707M probably benign Het
Olfr1013 T C 2: 85,770,269 V156A probably benign Het
Olfr1133 A T 2: 87,645,229 V298E probably damaging Het
Olfr568 A C 7: 102,877,797 S226R probably benign Het
Pcnx T A 12: 81,917,730 S224T probably damaging Het
Peak1 T C 9: 56,257,774 T957A probably damaging Het
Pex7 A T 10: 19,888,737 D153E probably damaging Het
Plscr1 A G 9: 92,266,424 E139G probably damaging Het
Psmb8 T C 17: 34,201,240 Y269H probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sft2d2 T C 1: 165,185,088 T80A probably damaging Het
Slc12a5 A G 2: 164,987,221 I583M possibly damaging Het
Slc23a4 T C 6: 34,957,022 M49V probably benign Het
Smarcb1 G A 10: 75,904,418 Q309* probably null Het
Sphkap A T 1: 83,278,285 V294E probably benign Het
Stoml1 C A 9: 58,253,370 P35Q probably damaging Het
Timm10b G C 7: 105,641,122 R42P probably damaging Het
Tnfrsf8 A T 4: 145,292,633 S211T possibly damaging Het
Ttn T C 2: 76,705,820 T26738A probably damaging Het
Vps13d A T 4: 145,074,882 Y474N probably damaging Het
Wdr81 A T 11: 75,445,906 F1552L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wnt7a A C 6: 91,394,655 Y108* probably null Het
Zfp512b C T 2: 181,585,668 R56K probably benign Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGCCAAGGCGTGTTGAC -3'
(R):5'- ATCATAACTAGCACACGGGG -3'

Sequencing Primer
(F):5'- AAGGCGTGTTGACCTCCGTAC -3'
(R):5'- TCCAGAGGTCCTGAGTTCAAATC -3'
Posted On2016-11-08