Incidental Mutation 'R5633:Ikzf2'
ID439955
Institutional Source Beutler Lab
Gene Symbol Ikzf2
Ensembl Gene ENSMUSG00000025997
Gene NameIKAROS family zinc finger 2
SynonymsA730095J18Rik, Zfpn1a2, Helios
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location69531214-69687245 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 69539097 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 273 (Q273*)
Ref Sequence ENSEMBL: ENSMUSP00000139530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027146] [ENSMUST00000187184] [ENSMUST00000188110] [ENSMUST00000190771] [ENSMUST00000190855] [ENSMUST00000191262]
Predicted Effect probably null
Transcript: ENSMUST00000027146
AA Change: Q418*
SMART Domains Protein: ENSMUSP00000027146
Gene: ENSMUSG00000025997
AA Change: Q418*

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 112 134 7.67e-2 SMART
ZnF_C2H2 140 162 1.72e-4 SMART
ZnF_C2H2 168 190 3.95e-4 SMART
ZnF_C2H2 196 219 3.58e-2 SMART
ZnF_C2H2 471 493 9.46e0 SMART
ZnF_C2H2 499 523 6.13e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187100
Predicted Effect probably null
Transcript: ENSMUST00000187184
AA Change: Q392*
SMART Domains Protein: ENSMUSP00000141075
Gene: ENSMUSG00000025997
AA Change: Q392*

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 1.72e-4 SMART
ZnF_C2H2 142 164 3.95e-4 SMART
ZnF_C2H2 170 193 3.58e-2 SMART
ZnF_C2H2 445 467 9.46e0 SMART
ZnF_C2H2 473 497 6.13e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188110
AA Change: Q346*
SMART Domains Protein: ENSMUSP00000140069
Gene: ENSMUSG00000025997
AA Change: Q346*

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 7.3e-7 SMART
ZnF_C2H2 142 164 1.6e-6 SMART
ZnF_C2H2 399 421 4e-2 SMART
ZnF_C2H2 427 451 2.6e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190771
AA Change: Q424*
SMART Domains Protein: ENSMUSP00000139543
Gene: ENSMUSG00000025997
AA Change: Q424*

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
ZnF_C2H2 118 140 3.2e-4 SMART
ZnF_C2H2 146 168 7.3e-7 SMART
ZnF_C2H2 174 196 1.6e-6 SMART
ZnF_C2H2 202 225 1.5e-4 SMART
ZnF_C2H2 477 499 4e-2 SMART
ZnF_C2H2 505 529 2.6e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190855
AA Change: Q344*
SMART Domains Protein: ENSMUSP00000140043
Gene: ENSMUSG00000025997
AA Change: Q344*

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 7.3e-7 SMART
ZnF_C2H2 142 164 1.6e-6 SMART
ZnF_C2H2 170 193 1.5e-4 SMART
ZnF_C2H2 397 419 4e-2 SMART
ZnF_C2H2 425 449 2.6e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191262
AA Change: Q273*
SMART Domains Protein: ENSMUSP00000139530
Gene: ENSMUSG00000025997
AA Change: Q273*

DomainStartEndE-ValueType
ZnF_C2H2 51 74 1.5e-4 SMART
ZnF_C2H2 326 348 4e-2 SMART
ZnF_C2H2 354 378 2.6e-3 SMART
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This protein forms homo- or hetero-dimers with other Ikaros family members, and is thought to function predominantly in early hematopoietic development. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit postnatal lethality for unknown reasons. Survivors have decreased body weight. Postnatal lethality has complete penetrance on the C57BL/6 strain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Ikzf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Ikzf2 APN 1 69539322 missense possibly damaging 0.77
IGL01295:Ikzf2 APN 1 69577987 missense probably benign 0.13
IGL01313:Ikzf2 APN 1 69539430 missense probably damaging 0.98
IGL01390:Ikzf2 APN 1 69570642 missense probably damaging 1.00
IGL01862:Ikzf2 APN 1 69538898 missense probably damaging 0.99
Freefall UTSW 1 69539097 nonsense probably null
Wigwam UTSW 1 69577796 nonsense probably null
R1079:Ikzf2 UTSW 1 69539105 missense possibly damaging 0.62
R1368:Ikzf2 UTSW 1 69539315 missense possibly damaging 0.95
R1661:Ikzf2 UTSW 1 69538814 missense probably damaging 0.99
R1665:Ikzf2 UTSW 1 69538814 missense probably damaging 0.99
R1688:Ikzf2 UTSW 1 69542280 missense possibly damaging 0.77
R1726:Ikzf2 UTSW 1 69548688 missense probably damaging 1.00
R1829:Ikzf2 UTSW 1 69542287 missense probably benign 0.34
R1860:Ikzf2 UTSW 1 69570502 missense probably damaging 1.00
R2507:Ikzf2 UTSW 1 69539288 missense probably benign 0.11
R4457:Ikzf2 UTSW 1 69684188 unclassified probably benign
R5666:Ikzf2 UTSW 1 69577900 missense probably benign 0.04
R5670:Ikzf2 UTSW 1 69577900 missense probably benign 0.04
R5836:Ikzf2 UTSW 1 69539387 missense probably damaging 1.00
R5950:Ikzf2 UTSW 1 69683244 missense probably damaging 1.00
R6492:Ikzf2 UTSW 1 69539042 missense probably damaging 1.00
R6758:Ikzf2 UTSW 1 69538900 missense probably damaging 0.97
R6809:Ikzf2 UTSW 1 69570502 missense probably damaging 1.00
R6946:Ikzf2 UTSW 1 69577796 nonsense probably null
R6959:Ikzf2 UTSW 1 69538770 makesense probably null
R7044:Ikzf2 UTSW 1 69538901 missense possibly damaging 0.93
R7236:Ikzf2 UTSW 1 69539081 missense probably benign 0.00
R7256:Ikzf2 UTSW 1 69578053 intron probably null
R7488:Ikzf2 UTSW 1 69539385 missense probably benign 0.45
X0027:Ikzf2 UTSW 1 69577852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACACTTGAAGGCCCTTATC -3'
(R):5'- ACCAAGCACAATCGCTGAGG -3'

Sequencing Primer
(F):5'- ACACTTGAAGGCCCTTATCTGTTC -3'
(R):5'- TGGCCCCAGTTATAAGCTCAG -3'
Posted On2016-11-08