Incidental Mutation 'R5633:Bcas2'
ID439966
Institutional Source Beutler Lab
Gene Symbol Bcas2
Ensembl Gene ENSMUSG00000005687
Gene Namebreast carcinoma amplified sequence 2
SynonymsC76366, 6430539P16Rik
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103171655-103179166 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 103178424 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 207 (Y207*)
Ref Sequence ENSEMBL: ENSMUSP00000005830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005830] [ENSMUST00000135017] [ENSMUST00000155520]
Predicted Effect probably null
Transcript: ENSMUST00000005830
AA Change: Y207*
SMART Domains Protein: ENSMUSP00000005830
Gene: ENSMUSG00000005687
AA Change: Y207*

DomainStartEndE-ValueType
Pfam:BCAS2 11 216 6.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135017
SMART Domains Protein: ENSMUSP00000122413
Gene: ENSMUSG00000005687

DomainStartEndE-ValueType
Pfam:BCAS2 6 77 2.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147042
Predicted Effect probably benign
Transcript: ENSMUST00000155520
SMART Domains Protein: ENSMUSP00000116250
Gene: ENSMUSG00000005687

DomainStartEndE-ValueType
Pfam:BCAS2 6 46 9e-10 PFAM
low complexity region 52 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182561
Meta Mutation Damage Score 0.616 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality. Pups of dams homozygous for a conditional allele activated in oocytes exhibit lethality of pups associated with defects in DNA damage repair and DNA replication. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Bcas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Bcas2 APN 3 103171999 missense probably damaging 1.00
IGL02557:Bcas2 APN 3 103171867 unclassified probably benign
R1911:Bcas2 UTSW 3 103171797 nonsense probably null
R2284:Bcas2 UTSW 3 103178362 missense probably damaging 1.00
R4574:Bcas2 UTSW 3 103174350 missense probably benign 0.01
R4676:Bcas2 UTSW 3 103175701 intron probably benign
R5335:Bcas2 UTSW 3 103175635 missense probably damaging 0.99
R5624:Bcas2 UTSW 3 103173261 missense probably benign
R5723:Bcas2 UTSW 3 103177292 intron probably benign
R6051:Bcas2 UTSW 3 103174341 missense possibly damaging 0.83
R6301:Bcas2 UTSW 3 103171871 unclassified probably benign
R6444:Bcas2 UTSW 3 103172046 splice site probably null
Predicted Primers PCR Primer
(F):5'- TAATGCAGAGAGCCCCTGTG -3'
(R):5'- TTTGCTAAGACACTCACACAGAAGC -3'

Sequencing Primer
(F):5'- GAGAGCCCCTGTGTACCCTTC -3'
(R):5'- AGCAATACAACAGTTTACATAGTCC -3'
Posted On2016-11-08