Incidental Mutation 'R5633:Chil6'
ID439967
Institutional Source Beutler Lab
Gene Symbol Chil6
Ensembl Gene ENSMUSG00000027902
Gene Namechitinase-like 6
SynonymsBYm, BC051070
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location106387384-106406182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106388752 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 389 (C389F)
Ref Sequence ENSEMBL: ENSMUSP00000029510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029510]
Predicted Effect probably damaging
Transcript: ENSMUST00000029510
AA Change: C389F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029510
Gene: ENSMUSG00000027902
AA Change: C389F

DomainStartEndE-ValueType
Glyco_18 39 382 3.04e-122 SMART
Meta Mutation Damage Score 0.602 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Chil6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Chil6 APN 3 106388825 missense probably damaging 1.00
IGL01735:Chil6 APN 3 106388688 critical splice donor site probably null
IGL01795:Chil6 APN 3 106388792 missense probably damaging 0.96
IGL02505:Chil6 APN 3 106405962 missense probably benign
IGL03164:Chil6 APN 3 106394398 missense probably benign 0.04
cold_cut UTSW 3 106389974 missense probably damaging 1.00
R0409:Chil6 UTSW 3 106404176 missense probably benign 0.44
R1761:Chil6 UTSW 3 106394338 missense probably damaging 1.00
R1967:Chil6 UTSW 3 106391154 missense possibly damaging 0.84
R2571:Chil6 UTSW 3 106390393 nonsense probably null
R3024:Chil6 UTSW 3 106388770 missense probably damaging 1.00
R3829:Chil6 UTSW 3 106405958 missense probably benign 0.00
R4835:Chil6 UTSW 3 106405974 nonsense probably null
R4851:Chil6 UTSW 3 106389928 missense possibly damaging 0.61
R4948:Chil6 UTSW 3 106388672 intron probably benign
R5056:Chil6 UTSW 3 106394343 missense probably damaging 1.00
R5244:Chil6 UTSW 3 106389974 missense probably damaging 1.00
R5555:Chil6 UTSW 3 106389952 missense possibly damaging 0.87
R5594:Chil6 UTSW 3 106394429 splice site probably null
R6194:Chil6 UTSW 3 106404876 critical splice donor site probably null
R6587:Chil6 UTSW 3 106404881 missense probably benign
R6613:Chil6 UTSW 3 106389875 missense probably benign 0.25
R6641:Chil6 UTSW 3 106388924 missense possibly damaging 0.61
R6651:Chil6 UTSW 3 106404260 missense probably damaging 1.00
R7094:Chil6 UTSW 3 106404170 missense probably damaging 0.96
R7161:Chil6 UTSW 3 106394412 missense probably benign 0.01
R7653:Chil6 UTSW 3 106394325 missense possibly damaging 0.82
X0026:Chil6 UTSW 3 106388968 missense probably benign 0.02
X0064:Chil6 UTSW 3 106404319 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGTATGGTAGTTAGCAGTTAAAG -3'
(R):5'- CCATGGCAATGAGTGGGTTG -3'

Sequencing Primer
(F):5'- CACGTATACACCTTCTGC -3'
(R):5'- GTTGGCTATGACAATATCAAGAGC -3'
Posted On2016-11-08