Incidental Mutation 'R5633:Eef2k'
ID439979
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Nameeukaryotic elongation factor-2 kinase
SynonymseEF-2K
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120842831-120907450 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 120873290 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000143322]
Predicted Effect probably benign
Transcript: ENSMUST00000047875
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106488
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106489
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141810
Predicted Effect probably benign
Transcript: ENSMUST00000143322
SMART Domains Protein: ENSMUSP00000115486
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 6e-15 BLAST
Blast:Alpha_kinase 120 160 1e-21 BLAST
SCOP:d1ia9a_ 129 160 3e-7 SMART
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1639:Eef2k UTSW 7 120885828 missense probably damaging 1.00
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R3856:Eef2k UTSW 7 120899371 nonsense probably null
R4024:Eef2k UTSW 7 120858598 missense probably benign 0.01
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5501:Eef2k UTSW 7 120889248 missense probably benign 0.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R7002:Eef2k UTSW 7 120891932 missense probably benign
R7166:Eef2k UTSW 7 120884772 missense probably damaging 1.00
R7254:Eef2k UTSW 7 120889265 missense probably benign 0.11
R7486:Eef2k UTSW 7 120858570 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCGACTTCTGTCCATAGGC -3'
(R):5'- TGTAAGAATCTGAAATTGGGGTGC -3'

Sequencing Primer
(F):5'- GACTTCTGTCCATAGGCTAAGC -3'
(R):5'- TTTCTTTGACCAGAAGCAGGACC -3'
Posted On2016-11-08