Incidental Mutation 'R5633:P4htm'
ID439983
Institutional Source Beutler Lab
Gene Symbol P4htm
Ensembl Gene ENSMUSG00000006675
Gene Nameprolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
SynonymsP4h-tm, 4933406E20Rik
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108578862-108597667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108579723 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 428 (D428E)
Ref Sequence ENSEMBL: ENSMUSP00000006853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000068700] [ENSMUST00000193621]
Predicted Effect probably damaging
Transcript: ENSMUST00000006853
AA Change: D428E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675
AA Change: D428E

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068700
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191674
Predicted Effect probably benign
Transcript: ENSMUST00000192080
Predicted Effect probably benign
Transcript: ENSMUST00000193621
SMART Domains Protein: ENSMUSP00000141843
Gene: ENSMUSG00000006675

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Blast:P4Hc 143 211 5e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195181
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of prolyl 4-hydroxylases. This protein is a prolyl hydroxylase that may be involved in the degradation of hypoxia-inducible transcription factors under normoxia. It plays a role in adaptation to hypoxia and may be related to cellular oxygen sensing. Alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body weight, normal erythropoiesis, and cardioprotection after ischemia-reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in P4htm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:P4htm APN 9 108583736 missense probably damaging 1.00
IGL02205:P4htm APN 9 108581962 missense probably benign 0.08
IGL02756:P4htm APN 9 108579778 missense probably damaging 1.00
IGL02802:P4htm UTSW 9 108582856 missense probably benign 0.00
R0605:P4htm UTSW 9 108583724 missense probably null 0.17
R3922:P4htm UTSW 9 108582895 missense probably benign
R4562:P4htm UTSW 9 108581996 missense probably null 1.00
R4730:P4htm UTSW 9 108579772 missense possibly damaging 0.89
R4900:P4htm UTSW 9 108579228 missense probably damaging 1.00
R5027:P4htm UTSW 9 108579293 missense probably benign 0.16
R5124:P4htm UTSW 9 108581942 missense possibly damaging 0.59
R5877:P4htm UTSW 9 108583733 missense possibly damaging 0.94
R5927:P4htm UTSW 9 108597383 missense probably damaging 1.00
R6163:P4htm UTSW 9 108581951 missense probably damaging 0.99
R6798:P4htm UTSW 9 108582918 missense possibly damaging 0.83
R6920:P4htm UTSW 9 108583613 missense probably benign 0.01
R6962:P4htm UTSW 9 108579195 missense possibly damaging 0.49
R7066:P4htm UTSW 9 108596963 missense probably damaging 0.98
R7183:P4htm UTSW 9 108581860 missense possibly damaging 0.95
R7376:P4htm UTSW 9 108580792 missense probably damaging 0.98
R7506:P4htm UTSW 9 108583679 missense probably damaging 1.00
R7533:P4htm UTSW 9 108596937 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGAGAGAAGTTTCCCTGCC -3'
(R):5'- TGTACACACCCTTCCAGAGC -3'

Sequencing Primer
(F):5'- GAGAAGTTTCCCTGCCCCAGAC -3'
(R):5'- AACCTTGGCTGCCTGGTC -3'
Posted On2016-11-08