Mutagenetix > Incidental Mutation

Incidental Mutation 'R5633:Trpm2'

439984

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

Trrp7, TRPC7, LTRPC2, 9830168K16Rik

MMRRC Submission

043284-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R5633 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77743556-77805746 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77774187 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 471 (I471V)

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105400

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105401
AA Change: I471V

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: I471V

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126206

Meta Mutation Damage Score

0.2446

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	T	A	4: 144,344,598 (GRCm39)	C125S	probably benign	Het
Abcb8	T	C	5: 24,608,107 (GRCm39)	L382P	probably damaging	Het
Acot3	A	G	12: 84,105,724 (GRCm39)		probably null	Het
Acsl6	A	T	11: 54,228,015 (GRCm39)	Q345L	probably benign	Het
Adcy8	A	G	15: 64,571,134 (GRCm39)	S1170P	probably damaging	Het
Ankrd28	T	G	14: 31,457,022 (GRCm39)	D182A	probably damaging	Het
B3galt5	A	T	16: 96,116,709 (GRCm39)	H114L	probably benign	Het
Bcas2	T	A	3: 103,085,740 (GRCm39)	Y207*	probably null	Het
Best1	A	G	19: 9,969,467 (GRCm39)	L197P	probably benign	Het
Chil6	C	A	3: 106,296,068 (GRCm39)	C389F	probably damaging	Het
Chrna4	T	C	2: 180,671,253 (GRCm39)	T168A	probably damaging	Het
Ckmt1	C	G	2: 121,194,110 (GRCm39)		probably benign	Het
Dhcr7	T	C	7: 143,401,160 (GRCm39)	L441P	probably damaging	Het
Dmtn	T	C	14: 70,842,419 (GRCm39)	M365V	probably benign	Het
Dmxl1	T	A	18: 50,010,764 (GRCm39)	S974T	probably damaging	Het
Dnajb13	T	C	7: 100,156,626 (GRCm39)	D150G	probably benign	Het
Eef2k	C	A	7: 120,472,513 (GRCm39)		probably benign	Het
Elp2	T	A	18: 24,748,267 (GRCm39)	V213E	probably damaging	Het
Fbxo43	A	T	15: 36,162,241 (GRCm39)		probably null	Het
Gm11559	C	A	11: 99,755,412 (GRCm39)	C20*	probably null	Het
Gnb2	T	C	5: 137,527,454 (GRCm39)	I213V	probably benign	Het
Gnb5	C	T	9: 75,251,796 (GRCm39)	T306I	probably damaging	Het
Ica1	A	T	6: 8,667,257 (GRCm39)	I303N	possibly damaging	Het
Idh1	A	G	1: 65,204,295 (GRCm39)	Y272H	probably damaging	Het
Ikzf2	G	A	1: 69,578,256 (GRCm39)	Q273*	probably null	Het
Itpkb	A	T	1: 180,154,790 (GRCm39)	⇒1	probably benign	Het
Kntc1	C	T	5: 123,957,120 (GRCm39)	T2143I	probably damaging	Het
Lin9	T	A	1: 180,496,763 (GRCm39)	L351I	probably benign	Het
Lmbrd1	C	A	1: 24,787,943 (GRCm39)	D464E	possibly damaging	Het
Med13	A	G	11: 86,169,757 (GRCm39)		probably benign	Het
Mn1	T	C	5: 111,568,192 (GRCm39)	F721L	possibly damaging	Het
Myo9a	T	A	9: 59,775,467 (GRCm39)	L1026Q	possibly damaging	Het
Or6c204	A	T	10: 129,022,718 (GRCm39)	F191I	probably benign	Het
P4htm	A	C	9: 108,456,922 (GRCm39)	D428E	probably damaging	Het
Parp8	C	T	13: 117,013,116 (GRCm39)	R602H	probably damaging	Het
Pkd2	T	A	5: 104,646,372 (GRCm39)	S726R	probably damaging	Het
Pla2g6	A	T	15: 79,183,342 (GRCm39)	I495N	possibly damaging	Het
Psmd5	A	G	2: 34,746,500 (GRCm39)	I359T	probably benign	Het
Rassf6	T	C	5: 90,751,977 (GRCm39)	H292R	possibly damaging	Het
Rnf145	T	C	11: 44,450,915 (GRCm39)	I413T	probably damaging	Het
Rpn2	T	A	2: 157,125,516 (GRCm39)	V9D	possibly damaging	Het
Rpp30	T	C	19: 36,064,390 (GRCm39)	L57P	probably damaging	Het
Slc41a1	A	G	1: 131,774,325 (GRCm39)	H464R	possibly damaging	Het
Slc47a1	G	T	11: 61,260,087 (GRCm39)	P163Q	probably damaging	Het
Smc4	T	A	3: 68,915,443 (GRCm39)	I165K	probably damaging	Het
Stra6l	T	A	4: 45,881,455 (GRCm39)	I439K	probably benign	Het
Syt9	C	T	7: 107,024,503 (GRCm39)	T132I	probably damaging	Het
Timd6	C	T	11: 46,465,433 (GRCm39)	S9L	unknown	Het
Uap1l1	A	G	2: 25,253,361 (GRCm39)	M358T	probably benign	Het
Vmn1r91	A	T	7: 19,835,870 (GRCm39)	H263L	possibly damaging	Het
Zfp407	T	C	18: 84,579,169 (GRCm39)	D648G	probably benign	Het
Zpbp2	T	C	11: 98,445,584 (GRCm39)	I150T	probably damaging	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77,778,749 (GRCm39)	splice site	probably null
IGL00773:Trpm2	APN	10	77,785,048 (GRCm39)	nonsense	probably null
IGL00962:Trpm2	APN	10	77,779,750 (GRCm39)	splice site	probably benign
IGL01093:Trpm2	APN	10	77,768,114 (GRCm39)	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77,781,659 (GRCm39)	splice site	probably benign
IGL01301:Trpm2	APN	10	77,759,818 (GRCm39)	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77,778,830 (GRCm39)	nonsense	probably null
IGL02175:Trpm2	APN	10	77,773,741 (GRCm39)	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77,748,503 (GRCm39)	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77,771,776 (GRCm39)	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77,771,776 (GRCm39)	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77,754,820 (GRCm39)	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77,765,112 (GRCm39)	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77,754,743 (GRCm39)	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77,753,568 (GRCm39)	missense	probably benign
IGL03405:Trpm2	APN	10	77,801,906 (GRCm39)	splice site	probably benign
Fugit	UTSW	10	77,774,202 (GRCm39)	missense	probably damaging	1.00
scusate	UTSW	10	77,802,828 (GRCm39)	nonsense	probably null
temporal	UTSW	10	77,761,516 (GRCm39)	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77,759,818 (GRCm39)	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77,761,659 (GRCm39)	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77,761,659 (GRCm39)	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77,779,824 (GRCm39)	splice site	probably benign
R0332:Trpm2	UTSW	10	77,783,822 (GRCm39)	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77,759,350 (GRCm39)	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77,765,122 (GRCm39)	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77,759,398 (GRCm39)	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77,801,841 (GRCm39)	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77,802,828 (GRCm39)	nonsense	probably null
R1518:Trpm2	UTSW	10	77,778,839 (GRCm39)	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77,778,833 (GRCm39)	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77,778,910 (GRCm39)	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77,771,709 (GRCm39)	splice site	probably null
R1673:Trpm2	UTSW	10	77,778,778 (GRCm39)	missense	probably benign
R1912:Trpm2	UTSW	10	77,781,710 (GRCm39)	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77,776,992 (GRCm39)	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77,783,823 (GRCm39)	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77,761,600 (GRCm39)	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77,768,013 (GRCm39)	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77,756,305 (GRCm39)	nonsense	probably null
R2217:Trpm2	UTSW	10	77,777,016 (GRCm39)	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77,754,798 (GRCm39)	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77,750,640 (GRCm39)	splice site	probably benign
R2395:Trpm2	UTSW	10	77,783,714 (GRCm39)	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77,766,471 (GRCm39)	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77,770,558 (GRCm39)	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77,777,008 (GRCm39)	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77,766,368 (GRCm39)	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77,766,368 (GRCm39)	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77,747,208 (GRCm39)	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77,768,136 (GRCm39)	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77,771,824 (GRCm39)	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77,771,824 (GRCm39)	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77,769,476 (GRCm39)	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77,753,559 (GRCm39)	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77,765,053 (GRCm39)	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77,770,902 (GRCm39)	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77,759,427 (GRCm39)	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77,781,750 (GRCm39)	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77,773,972 (GRCm39)	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77,777,007 (GRCm39)	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77,768,023 (GRCm39)	nonsense	probably null
R4943:Trpm2	UTSW	10	77,801,841 (GRCm39)	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77,753,626 (GRCm39)	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77,801,852 (GRCm39)	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77,759,355 (GRCm39)	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77,771,795 (GRCm39)	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77,795,773 (GRCm39)	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77,767,973 (GRCm39)	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77,748,470 (GRCm39)	missense	probably benign	0.00
R5817:Trpm2	UTSW	10	77,801,814 (GRCm39)	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77,795,734 (GRCm39)	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77,753,547 (GRCm39)	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77,770,877 (GRCm39)	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77,761,516 (GRCm39)	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77,774,202 (GRCm39)	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77,768,061 (GRCm39)	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77,773,660 (GRCm39)	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77,773,660 (GRCm39)	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77,773,660 (GRCm39)	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77,773,660 (GRCm39)	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77,750,574 (GRCm39)	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77,771,725 (GRCm39)	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77,748,426 (GRCm39)	missense	probably benign
R7036:Trpm2	UTSW	10	77,748,426 (GRCm39)	missense	probably benign
R7113:Trpm2	UTSW	10	77,783,765 (GRCm39)	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77,759,848 (GRCm39)	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77,771,710 (GRCm39)	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77,759,389 (GRCm39)	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77,750,568 (GRCm39)	missense	probably benign
R7527:Trpm2	UTSW	10	77,801,894 (GRCm39)	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77,773,784 (GRCm39)	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77,773,885 (GRCm39)	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77,761,623 (GRCm39)	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77,768,013 (GRCm39)	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77,759,340 (GRCm39)	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77,783,731 (GRCm39)	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77,783,807 (GRCm39)	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77,783,807 (GRCm39)	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77,771,836 (GRCm39)	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77,801,859 (GRCm39)	nonsense	probably null
R8340:Trpm2	UTSW	10	77,759,458 (GRCm39)	nonsense	probably null
R8354:Trpm2	UTSW	10	77,769,483 (GRCm39)	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77,747,236 (GRCm39)	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77,746,086 (GRCm39)	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77,768,128 (GRCm39)	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77,765,122 (GRCm39)	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77,777,014 (GRCm39)	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77,785,032 (GRCm39)	missense	probably damaging	1.00
R9319:Trpm2	UTSW	10	77,778,776 (GRCm39)	nonsense	probably null
R9381:Trpm2	UTSW	10	77,747,191 (GRCm39)	missense	possibly damaging	0.90
R9457:Trpm2	UTSW	10	77,747,226 (GRCm39)	missense	possibly damaging	0.82
R9477:Trpm2	UTSW	10	77,747,224 (GRCm39)	missense	probably benign	0.12
R9547:Trpm2	UTSW	10	77,748,467 (GRCm39)	missense	probably benign	0.33
R9660:Trpm2	UTSW	10	77,766,389 (GRCm39)	missense	probably benign	0.00
R9663:Trpm2	UTSW	10	77,756,320 (GRCm39)	missense	probably benign	0.01
Z1177:Trpm2	UTSW	10	77,773,702 (GRCm39)	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ACTCAGGCTTGTTGGAGATGAG -3'
(R):5'- AATTCCTGGCCAACTCCTGAG -3'

Sequencing Primer
(F):5'- ATGAGAGCGGCCGTCATCATG -3'
(R):5'- AACTCCTGAGCCTGGCAC -3'

Posted On

2016-11-08