Incidental Mutation 'R5633:Fbxo43'
ID439998
Institutional Source Beutler Lab
Gene Symbol Fbxo43
Ensembl Gene ENSMUSG00000048230
Gene NameF-box protein 43
Synonymsearly mitotic inhibitor 2, XErp1 homolog, 4930533G20Rik, Emi2, endogenous meiotic inhibitor 2
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location36150060-36164884 bp(-) (GRCm38)
Type of Mutationunclassified (477 bp from exon)
DNA Base Change (assembly) A to T at 36162095 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058643] [ENSMUST00000227793]
Predicted Effect probably null
Transcript: ENSMUST00000058643
AA Change: L322*
SMART Domains Protein: ENSMUSP00000054125
Gene: ENSMUSG00000048230
AA Change: L322*

DomainStartEndE-ValueType
low complexity region 88 100 N/A INTRINSIC
low complexity region 393 406 N/A INTRINSIC
Blast:FBOX 439 479 2e-14 BLAST
low complexity region 502 515 N/A INTRINSIC
IBR 555 614 1.46e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227781
Predicted Effect probably null
Transcript: ENSMUST00000227793
Meta Mutation Damage Score 0.5884 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO43, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Fbxo43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Fbxo43 APN 15 36151826 missense probably damaging 1.00
IGL02212:Fbxo43 APN 15 36151811 missense probably damaging 0.99
IGL02246:Fbxo43 APN 15 36162696 missense probably benign 0.06
IGL02576:Fbxo43 APN 15 36152175 missense probably benign 0.01
FR4304:Fbxo43 UTSW 15 36152094 small insertion probably benign
FR4304:Fbxo43 UTSW 15 36152097 small insertion probably benign
FR4304:Fbxo43 UTSW 15 36152100 small insertion probably benign
FR4548:Fbxo43 UTSW 15 36152098 nonsense probably null
FR4589:Fbxo43 UTSW 15 36152100 small insertion probably benign
FR4589:Fbxo43 UTSW 15 36152101 small insertion probably benign
R0193:Fbxo43 UTSW 15 36161883 missense probably benign 0.29
R0244:Fbxo43 UTSW 15 36161793 missense probably damaging 1.00
R0322:Fbxo43 UTSW 15 36152192 splice site probably benign
R0409:Fbxo43 UTSW 15 36162357 missense probably benign 0.01
R0827:Fbxo43 UTSW 15 36162969 missense possibly damaging 0.90
R1562:Fbxo43 UTSW 15 36163016 missense probably damaging 0.99
R1880:Fbxo43 UTSW 15 36162515 missense probably benign 0.02
R2051:Fbxo43 UTSW 15 36162132 missense probably damaging 1.00
R3792:Fbxo43 UTSW 15 36162859 missense probably benign 0.03
R3875:Fbxo43 UTSW 15 36162103 missense probably benign
R3876:Fbxo43 UTSW 15 36152112 missense probably damaging 1.00
R5023:Fbxo43 UTSW 15 36162929 missense probably benign 0.13
R5997:Fbxo43 UTSW 15 36162093 missense probably damaging 1.00
R6589:Fbxo43 UTSW 15 36162540 missense probably damaging 0.99
R7238:Fbxo43 UTSW 15 36151825 missense probably damaging 1.00
R7536:Fbxo43 UTSW 15 36161851 missense not run
X0025:Fbxo43 UTSW 15 36152160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTCTGGCAATTTTCCC -3'
(R):5'- TTCTTCAGGAGAGGTGAGAGAC -3'

Sequencing Primer
(F):5'- AAAGAATTCCTGGTCATCTTCCTG -3'
(R):5'- GAGGTGAGAGACAGTCTTTTTACACC -3'
Posted On2016-11-08