Incidental Mutation 'R5633:Elp2'
ID440002
Institutional Source Beutler Lab
Gene Symbol Elp2
Ensembl Gene ENSMUSG00000024271
Gene Nameelongator acetyltransferase complex subunit 2
SynonymsStatip1, StIP1, Stat3-interacting protein
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location24603961-24638830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24615210 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 213 (V213E)
Ref Sequence ENSEMBL: ENSMUSP00000025120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025120]
Predicted Effect probably damaging
Transcript: ENSMUST00000025120
AA Change: V213E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025120
Gene: ENSMUSG00000024271
AA Change: V213E

DomainStartEndE-ValueType
WD40 47 91 1.06e-3 SMART
WD40 94 143 2.24e-2 SMART
WD40 196 237 4.69e-5 SMART
WD40 271 319 2.44e-3 SMART
Blast:WD40 329 368 1e-20 BLAST
WD40 376 415 2.12e-3 SMART
WD40 429 467 1.71e1 SMART
WD40 556 600 7.43e-1 SMART
WD40 603 642 1.93e-6 SMART
WD40 661 697 1.55e-5 SMART
Blast:WD40 709 753 7e-21 BLAST
WD40 766 825 1.92e0 SMART
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core subunit of the elongator complex, a histone acetyltransferase complex that associates with RNA polymerase II. In addition to histone acetylation, the encoded protein effects transcriptional elongation and may help remodel chromatin. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Elp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Elp2 APN 18 24617491 missense probably benign 0.01
IGL01909:Elp2 APN 18 24619519 splice site probably benign
IGL01974:Elp2 APN 18 24626203 missense probably damaging 0.99
IGL02243:Elp2 APN 18 24622606 missense probably benign 0.11
IGL03049:Elp2 APN 18 24631459 missense probably benign 0.05
IGL03236:Elp2 APN 18 24622243 splice site probably benign
IGL03380:Elp2 APN 18 24622480 missense probably benign 0.05
Camelid UTSW 18 24625549 missense probably damaging 1.00
PIT4283001:Elp2 UTSW 18 24622130 missense probably damaging 1.00
PIT4531001:Elp2 UTSW 18 24604113 missense probably damaging 0.99
R0119:Elp2 UTSW 18 24634409 missense probably benign 0.03
R0244:Elp2 UTSW 18 24631471 missense possibly damaging 0.81
R0299:Elp2 UTSW 18 24634409 missense probably benign 0.03
R0609:Elp2 UTSW 18 24626156 missense probably benign
R0671:Elp2 UTSW 18 24612442 splice site probably benign
R1531:Elp2 UTSW 18 24631404 missense probably benign 0.06
R1658:Elp2 UTSW 18 24617413 missense probably benign 0.27
R1673:Elp2 UTSW 18 24611926 missense possibly damaging 0.93
R2012:Elp2 UTSW 18 24631458 missense probably benign 0.00
R3861:Elp2 UTSW 18 24606920 missense probably benign 0.01
R4038:Elp2 UTSW 18 24634348 missense probably damaging 1.00
R4396:Elp2 UTSW 18 24609650 missense probably damaging 1.00
R4507:Elp2 UTSW 18 24626120 splice site probably null
R4901:Elp2 UTSW 18 24619485 missense probably damaging 1.00
R5389:Elp2 UTSW 18 24606903 missense possibly damaging 0.87
R5511:Elp2 UTSW 18 24612450 nonsense probably null
R5728:Elp2 UTSW 18 24617452 missense probably damaging 1.00
R6585:Elp2 UTSW 18 24625549 missense probably damaging 1.00
R6855:Elp2 UTSW 18 24606877 missense possibly damaging 0.48
R6877:Elp2 UTSW 18 24634976 missense probably benign 0.00
R7145:Elp2 UTSW 18 24604069 missense probably benign 0.42
R7163:Elp2 UTSW 18 24614446 missense probably benign 0.00
R7313:Elp2 UTSW 18 24609659 missense probably benign 0.05
R7318:Elp2 UTSW 18 24606899 missense probably damaging 1.00
R7403:Elp2 UTSW 18 24619485 missense probably damaging 1.00
R7497:Elp2 UTSW 18 24611928 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAGTTGGTTAGTTCTAGGCCC -3'
(R):5'- CACAGCTAGGCCATGAAGTTC -3'

Sequencing Primer
(F):5'- GGTTAGTTCTAGGCCCTTGTTTCC -3'
(R):5'- GGTTAAGGAACACCTTTTCTGAGCC -3'
Posted On2016-11-08