Mutagenetix > Incidental Mutation

Incidental Mutation 'R5633:Best1'

440005

Institutional Source

Beutler Lab

Gene Symbol

Best1

Ensembl Gene

ENSMUSG00000037418

Gene Name

bestrophin 1

Synonyms

best macular dystrophy, mBest1, Vmd2

MMRRC Submission

043284-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5633 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9962538-9978997 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9969467 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 197 (L197P)

Ref Sequence

ENSEMBL: ENSMUSP00000113053 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117346]

AlphaFold

O88870

Predicted Effect

probably benign
Transcript: ENSMUST00000117346
AA Change: L197P

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000113053
Gene: ENSMUSG00000037418
AA Change: L197P

Domain	Start	End	E-Value	Type
Pfam:Bestrophin	8	316	8.5e-111	PFAM
low complexity region	476	488	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144273

Meta Mutation Damage Score

0.3355

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutations of this gene generally result in abnormal retinal pigment epithelium morphology and/or altered eye electrophysiology. Homozygotes for a null allele show male subfertility associated with abnormal sperm morphology and reduced motility in the absence of retinal pathology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	T	A	4: 144,344,598 (GRCm39)	C125S	probably benign	Het
Abcb8	T	C	5: 24,608,107 (GRCm39)	L382P	probably damaging	Het
Acot3	A	G	12: 84,105,724 (GRCm39)		probably null	Het
Acsl6	A	T	11: 54,228,015 (GRCm39)	Q345L	probably benign	Het
Adcy8	A	G	15: 64,571,134 (GRCm39)	S1170P	probably damaging	Het
Ankrd28	T	G	14: 31,457,022 (GRCm39)	D182A	probably damaging	Het
B3galt5	A	T	16: 96,116,709 (GRCm39)	H114L	probably benign	Het
Bcas2	T	A	3: 103,085,740 (GRCm39)	Y207*	probably null	Het
Chil6	C	A	3: 106,296,068 (GRCm39)	C389F	probably damaging	Het
Chrna4	T	C	2: 180,671,253 (GRCm39)	T168A	probably damaging	Het
Ckmt1	C	G	2: 121,194,110 (GRCm39)		probably benign	Het
Dhcr7	T	C	7: 143,401,160 (GRCm39)	L441P	probably damaging	Het
Dmtn	T	C	14: 70,842,419 (GRCm39)	M365V	probably benign	Het
Dmxl1	T	A	18: 50,010,764 (GRCm39)	S974T	probably damaging	Het
Dnajb13	T	C	7: 100,156,626 (GRCm39)	D150G	probably benign	Het
Eef2k	C	A	7: 120,472,513 (GRCm39)		probably benign	Het
Elp2	T	A	18: 24,748,267 (GRCm39)	V213E	probably damaging	Het
Fbxo43	A	T	15: 36,162,241 (GRCm39)		probably null	Het
Gm11559	C	A	11: 99,755,412 (GRCm39)	C20*	probably null	Het
Gnb2	T	C	5: 137,527,454 (GRCm39)	I213V	probably benign	Het
Gnb5	C	T	9: 75,251,796 (GRCm39)	T306I	probably damaging	Het
Ica1	A	T	6: 8,667,257 (GRCm39)	I303N	possibly damaging	Het
Idh1	A	G	1: 65,204,295 (GRCm39)	Y272H	probably damaging	Het
Ikzf2	G	A	1: 69,578,256 (GRCm39)	Q273*	probably null	Het
Itpkb	A	T	1: 180,154,790 (GRCm39)	⇒1	probably benign	Het
Kntc1	C	T	5: 123,957,120 (GRCm39)	T2143I	probably damaging	Het
Lin9	T	A	1: 180,496,763 (GRCm39)	L351I	probably benign	Het
Lmbrd1	C	A	1: 24,787,943 (GRCm39)	D464E	possibly damaging	Het
Med13	A	G	11: 86,169,757 (GRCm39)		probably benign	Het
Mn1	T	C	5: 111,568,192 (GRCm39)	F721L	possibly damaging	Het
Myo9a	T	A	9: 59,775,467 (GRCm39)	L1026Q	possibly damaging	Het
Or6c204	A	T	10: 129,022,718 (GRCm39)	F191I	probably benign	Het
P4htm	A	C	9: 108,456,922 (GRCm39)	D428E	probably damaging	Het
Parp8	C	T	13: 117,013,116 (GRCm39)	R602H	probably damaging	Het
Pkd2	T	A	5: 104,646,372 (GRCm39)	S726R	probably damaging	Het
Pla2g6	A	T	15: 79,183,342 (GRCm39)	I495N	possibly damaging	Het
Psmd5	A	G	2: 34,746,500 (GRCm39)	I359T	probably benign	Het
Rassf6	T	C	5: 90,751,977 (GRCm39)	H292R	possibly damaging	Het
Rnf145	T	C	11: 44,450,915 (GRCm39)	I413T	probably damaging	Het
Rpn2	T	A	2: 157,125,516 (GRCm39)	V9D	possibly damaging	Het
Rpp30	T	C	19: 36,064,390 (GRCm39)	L57P	probably damaging	Het
Slc41a1	A	G	1: 131,774,325 (GRCm39)	H464R	possibly damaging	Het
Slc47a1	G	T	11: 61,260,087 (GRCm39)	P163Q	probably damaging	Het
Smc4	T	A	3: 68,915,443 (GRCm39)	I165K	probably damaging	Het
Stra6l	T	A	4: 45,881,455 (GRCm39)	I439K	probably benign	Het
Syt9	C	T	7: 107,024,503 (GRCm39)	T132I	probably damaging	Het
Timd6	C	T	11: 46,465,433 (GRCm39)	S9L	unknown	Het
Trpm2	T	C	10: 77,774,187 (GRCm39)	I471V	possibly damaging	Het
Uap1l1	A	G	2: 25,253,361 (GRCm39)	M358T	probably benign	Het
Vmn1r91	A	T	7: 19,835,870 (GRCm39)	H263L	possibly damaging	Het
Zfp407	T	C	18: 84,579,169 (GRCm39)	D648G	probably benign	Het
Zpbp2	T	C	11: 98,445,584 (GRCm39)	I150T	probably damaging	Het

Other mutations in Best1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01563:Best1	APN	19	9,964,099 (GRCm39)	missense	probably benign	0.22
IGL02129:Best1	APN	19	9,970,285 (GRCm39)	missense	probably benign
IGL02310:Best1	APN	19	9,966,516 (GRCm39)	missense	probably benign	0.00
IGL02470:Best1	APN	19	9,970,340 (GRCm39)	missense	probably benign	0.43
IGL02505:Best1	APN	19	9,966,514 (GRCm39)	missense	probably damaging	1.00
R0366:Best1	UTSW	19	9,969,417 (GRCm39)	splice site	probably null
R1476:Best1	UTSW	19	9,967,853 (GRCm39)	nonsense	probably null
R1674:Best1	UTSW	19	9,970,590 (GRCm39)	critical splice donor site	probably null
R2091:Best1	UTSW	19	9,969,443 (GRCm39)	missense	probably benign	0.27
R2516:Best1	UTSW	19	9,970,675 (GRCm39)	nonsense	probably null
R2866:Best1	UTSW	19	9,963,585 (GRCm39)	missense	probably benign
R4693:Best1	UTSW	19	9,974,499 (GRCm39)	missense	probably damaging	1.00
R4851:Best1	UTSW	19	9,969,062 (GRCm39)	missense	probably damaging	1.00
R4895:Best1	UTSW	19	9,970,135 (GRCm39)	missense	probably benign	0.00
R5700:Best1	UTSW	19	9,974,563 (GRCm39)	unclassified	probably benign
R5837:Best1	UTSW	19	9,966,483 (GRCm39)	splice site	probably null
R6893:Best1	UTSW	19	9,974,446 (GRCm39)	missense	probably damaging	1.00
R7021:Best1	UTSW	19	9,964,143 (GRCm39)	missense	probably benign
R7220:Best1	UTSW	19	9,969,479 (GRCm39)	missense	probably benign	0.31
R7267:Best1	UTSW	19	9,964,177 (GRCm39)	missense	probably benign	0.00
R7284:Best1	UTSW	19	9,963,737 (GRCm39)	critical splice acceptor site	probably null
R7489:Best1	UTSW	19	9,974,410 (GRCm39)	missense	possibly damaging	0.68
R7568:Best1	UTSW	19	9,966,639 (GRCm39)	critical splice acceptor site	probably null
R7798:Best1	UTSW	19	9,969,035 (GRCm39)	missense	probably damaging	1.00
R8192:Best1	UTSW	19	9,963,664 (GRCm39)	missense	possibly damaging	0.52
R8523:Best1	UTSW	19	9,969,027 (GRCm39)	missense	possibly damaging	0.91
R9570:Best1	UTSW	19	9,970,331 (GRCm39)	missense	probably damaging	1.00
X0065:Best1	UTSW	19	9,964,339 (GRCm39)	missense	probably benign	0.03
Z1177:Best1	UTSW	19	9,970,603 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGTGGGCTGTAGAATCTTG -3'
(R):5'- TGGGACTCAATAATTTTGTGCG -3'

Sequencing Primer
(F):5'- TCATATACTACCAGGACGGG -3'
(R):5'- GGACTCAATAATTTTGTGCGTTGAAG -3'

Posted On

2016-11-08