Incidental Mutation 'R5634:Cfap54'
ID440039
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5634 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) C to A at 92904263 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
Predicted Effect probably benign
Transcript: ENSMUST00000067705
Predicted Effect probably benign
Transcript: ENSMUST00000168110
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212902
Meta Mutation Damage Score 0.492 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,621 probably benign Het
Aen A T 7: 78,902,507 T34S probably benign Het
Apoh T A 11: 108,412,049 V280E probably damaging Het
Ccdc87 A G 19: 4,840,665 H395R probably benign Het
Ccrl2 T A 9: 111,055,987 probably null Het
Cdh20 T C 1: 104,975,075 F497S probably damaging Het
Cipc T A 12: 86,952,975 probably null Het
Col14a1 T A 15: 55,518,298 Y1756N probably damaging Het
Cyp2c54 G A 19: 40,072,414 A95V possibly damaging Het
Dcdc5 A G 2: 106,403,980 noncoding transcript Het
Dnah17 T C 11: 118,052,926 probably null Het
Eepd1 A T 9: 25,603,553 N552I probably benign Het
Eif2ak4 A T 2: 118,462,311 R1218W probably damaging Het
Fbxw18 T A 9: 109,676,803 I467F possibly damaging Het
Ffar4 GCTTCTT GCTT 19: 38,113,925 probably benign Het
Gm14025 A T 2: 129,039,486 D173E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm884 T C 11: 103,542,014 N1267S possibly damaging Het
Gpha2 A G 19: 6,226,860 T25A probably benign Het
Grin3a T A 4: 49,792,843 I297F probably damaging Het
Herc2 G A 7: 56,206,783 G3924R probably damaging Het
Hmcn2 G T 2: 31,333,881 D97Y probably damaging Het
Igdcc4 G A 9: 65,134,546 G1131D probably benign Het
Il18rap T C 1: 40,539,376 probably benign Het
Ino80d C A 1: 63,062,283 probably benign Het
Klhl1 T C 14: 96,240,271 T454A probably damaging Het
Krt84 C A 15: 101,528,649 V360L probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mapkbp1 A G 2: 119,973,095 N15S probably damaging Het
Med13l T C 5: 118,560,850 F22S possibly damaging Het
Mrc2 T A 11: 105,336,214 C548* probably null Het
Nacad T C 11: 6,602,387 E268G possibly damaging Het
Nfxl1 A G 5: 72,529,490 C527R probably damaging Het
Nphp1 A T 2: 127,759,650 C412S possibly damaging Het
Odf3b T A 15: 89,378,207 T70S probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1279 A G 2: 111,307,092 I296V probably benign Het
Per2 C T 1: 91,444,707 C215Y probably benign Het
Pias1 T C 9: 62,895,973 T343A probably benign Het
Pja2 C T 17: 64,292,867 V541M probably damaging Het
Plxna4 G A 6: 32,237,723 Q608* probably null Het
Ppil4 T A 10: 7,814,778 D398E probably benign Het
Ppp4r3a T A 12: 101,043,521 D8V probably damaging Het
Pstk A C 7: 131,371,343 D57A probably damaging Het
Ptprd T C 4: 76,072,018 I53V probably benign Het
Pyroxd2 A G 19: 42,740,485 F159L probably benign Het
Rnf103 A G 6: 71,509,617 M411V probably benign Het
Scn4a T C 11: 106,330,004 D943G probably benign Het
Sdk2 T C 11: 113,851,714 T790A probably damaging Het
Sfr1 T C 19: 47,733,871 L242P probably damaging Het
Snx25 T C 8: 46,041,391 D819G possibly damaging Het
Sult2b1 A G 7: 45,734,082 V183A probably damaging Het
Tcf4 C A 18: 69,636,847 S8R possibly damaging Het
Ttc7 A G 17: 87,342,087 D531G probably benign Het
Uap1l1 A C 2: 25,364,133 C271G probably damaging Het
Ubtf T C 11: 102,310,324 Y268C probably damaging Het
Zfp951 A T 5: 104,815,289 M137K probably benign Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.28
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CATGCTCTATTATGCACATTCACTG -3'
(R):5'- GAGCTAATAAACAGAGGCTTGC -3'

Sequencing Primer
(F):5'- CGCAGAGGGAGAATATACAC -3'
(R):5'- AGAGGCTTGCCCCACATTCTG -3'
Posted On2016-11-08