Incidental Mutation 'R5634:Scn4a'
ID440045
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission 043285-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5634 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106330004 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 943 (D943G)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably benign
Transcript: ENSMUST00000021056
AA Change: D943G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: D943G

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,621 probably benign Het
Aen A T 7: 78,902,507 T34S probably benign Het
Apoh T A 11: 108,412,049 V280E probably damaging Het
Ccdc87 A G 19: 4,840,665 H395R probably benign Het
Ccrl2 T A 9: 111,055,987 probably null Het
Cdh20 T C 1: 104,975,075 F497S probably damaging Het
Cfap54 C A 10: 92,904,263 probably benign Het
Cipc T A 12: 86,952,975 probably null Het
Col14a1 T A 15: 55,518,298 Y1756N probably damaging Het
Cyp2c54 G A 19: 40,072,414 A95V possibly damaging Het
Dcdc5 A G 2: 106,403,980 noncoding transcript Het
Dnah17 T C 11: 118,052,926 probably null Het
Eepd1 A T 9: 25,603,553 N552I probably benign Het
Eif2ak4 A T 2: 118,462,311 R1218W probably damaging Het
Fbxw18 T A 9: 109,676,803 I467F possibly damaging Het
Ffar4 GCTTCTT GCTT 19: 38,113,925 probably benign Het
Gm14025 A T 2: 129,039,486 D173E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm884 T C 11: 103,542,014 N1267S possibly damaging Het
Gpha2 A G 19: 6,226,860 T25A probably benign Het
Grin3a T A 4: 49,792,843 I297F probably damaging Het
Herc2 G A 7: 56,206,783 G3924R probably damaging Het
Hmcn2 G T 2: 31,333,881 D97Y probably damaging Het
Igdcc4 G A 9: 65,134,546 G1131D probably benign Het
Il18rap T C 1: 40,539,376 probably benign Het
Ino80d C A 1: 63,062,283 probably benign Het
Klhl1 T C 14: 96,240,271 T454A probably damaging Het
Krt84 C A 15: 101,528,649 V360L probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mapkbp1 A G 2: 119,973,095 N15S probably damaging Het
Med13l T C 5: 118,560,850 F22S possibly damaging Het
Mrc2 T A 11: 105,336,214 C548* probably null Het
Nacad T C 11: 6,602,387 E268G possibly damaging Het
Nfxl1 A G 5: 72,529,490 C527R probably damaging Het
Nphp1 A T 2: 127,759,650 C412S possibly damaging Het
Odf3b T A 15: 89,378,207 T70S probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1279 A G 2: 111,307,092 I296V probably benign Het
Per2 C T 1: 91,444,707 C215Y probably benign Het
Pias1 T C 9: 62,895,973 T343A probably benign Het
Pja2 C T 17: 64,292,867 V541M probably damaging Het
Plxna4 G A 6: 32,237,723 Q608* probably null Het
Ppil4 T A 10: 7,814,778 D398E probably benign Het
Ppp4r3a T A 12: 101,043,521 D8V probably damaging Het
Pstk A C 7: 131,371,343 D57A probably damaging Het
Ptprd T C 4: 76,072,018 I53V probably benign Het
Pyroxd2 A G 19: 42,740,485 F159L probably benign Het
Rnf103 A G 6: 71,509,617 M411V probably benign Het
Sdk2 T C 11: 113,851,714 T790A probably damaging Het
Sfr1 T C 19: 47,733,871 L242P probably damaging Het
Snx25 T C 8: 46,041,391 D819G possibly damaging Het
Sult2b1 A G 7: 45,734,082 V183A probably damaging Het
Tcf4 C A 18: 69,636,847 S8R possibly damaging Het
Ttc7 A G 17: 87,342,087 D531G probably benign Het
Uap1l1 A C 2: 25,364,133 C271G probably damaging Het
Ubtf T C 11: 102,310,324 Y268C probably damaging Het
Zfp951 A T 5: 104,815,289 M137K probably benign Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 intron probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGGAGCAAAGACTTAGCAGG -3'
(R):5'- TCATATCCTGAACCACGTGGG -3'

Sequencing Primer
(F):5'- ACTTAGCAGGGCCTTCAAG -3'
(R):5'- ACGTGGGCCTGACTGATG -3'
Posted On2016-11-08