Incidental Mutation 'R5512:Ncam1'
ID440107
Institutional Source Beutler Lab
Gene Symbol Ncam1
Ensembl Gene ENSMUSG00000039542
Gene Nameneural cell adhesion molecule 1
SynonymsNCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R5512 (G1)
Quality Score216
Status Not validated
Chromosome9
Chromosomal Location49502136-49798925 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 49509699 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000166811] [ENSMUST00000193547]
Predicted Effect probably null
Transcript: ENSMUST00000166811
SMART Domains Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000193547
SMART Domains Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000194252
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,350,660 V364A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Adgre5 T C 8: 83,729,086 N198D probably benign Het
Adgrf4 G T 17: 42,667,285 T389K probably benign Het
Apc T A 18: 34,310,909 probably benign Het
Appl2 T A 10: 83,605,818 I524F probably damaging Het
Arhgef37 G A 18: 61,499,774 Q531* probably null Het
Atp7b T C 8: 22,012,739 T694A probably benign Het
Cacna1g T A 11: 94,444,142 I780F probably damaging Het
Calcoco2 T C 11: 96,103,336 K95E probably damaging Het
Cars T C 7: 143,570,133 D388G possibly damaging Het
Ccdc150 A C 1: 54,354,647 E690A probably damaging Het
Cdc73 G T 1: 143,702,616 D3E probably damaging Het
Cdh23 C A 10: 60,534,386 probably null Het
Cep170b T C 12: 112,733,485 S143P possibly damaging Het
Cherp T C 8: 72,463,266 I607V possibly damaging Het
CN725425 T A 15: 91,240,756 H166Q probably benign Het
Dcaf6 A G 1: 165,399,835 V241A possibly damaging Het
Dot1l C T 10: 80,788,991 P881S possibly damaging Het
Dsg1c A T 18: 20,272,511 N327I probably damaging Het
Fam208b A T 13: 3,595,517 Y111N probably damaging Het
Fbxw7 G A 3: 84,954,909 R182H probably damaging Het
Fkbp1b A T 12: 4,838,183 V24E probably benign Het
Fut11 T C 14: 20,696,001 S304P probably damaging Het
Ggt1 C T 10: 75,584,884 T361I probably damaging Het
Gimap7 G T 6: 48,723,596 A39S probably benign Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm17541 G T 12: 4,689,452 probably benign Het
Gmip T A 8: 69,817,890 V750E probably benign Het
Gna14 A G 19: 16,608,128 E290G probably benign Het
Gpnmb T C 6: 49,045,464 V176A possibly damaging Het
Hhla1 T C 15: 65,924,016 K447R probably benign Het
Hsd3b1 A G 3: 98,853,205 Y157H probably benign Het
Iqgap2 G A 13: 95,675,376 Q706* probably null Het
Krt222 A C 11: 99,234,955 S283R probably damaging Het
Ldb2 G A 5: 44,480,244 R241W probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Masp2 A T 4: 148,614,069 I536F probably damaging Het
Mptx1 A G 1: 174,332,749 D207G probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Napsa A G 7: 44,572,616 M1V probably null Het
Nckap5 G A 1: 126,027,744 P425L possibly damaging Het
Nol8 A G 13: 49,676,787 S1116G probably benign Het
Nrde2 G T 12: 100,142,250 Q361K probably benign Het
Nudt13 G A 14: 20,307,732 G133D probably damaging Het
Ofcc1 G T 13: 40,206,810 Q248K probably benign Het
Olfm4 A G 14: 80,021,347 D345G probably benign Het
Olfr1287 G A 2: 111,449,754 V205I probably benign Het
Olfr720 C A 14: 14,175,633 G150C probably damaging Het
Osbpl3 T G 6: 50,309,360 K659N probably damaging Het
Pdk2 G A 11: 95,039,466 T48M probably damaging Het
Phf11a A T 14: 59,287,550 D68E probably benign Het
Prrxl1 A G 14: 32,600,044 H5R probably damaging Het
Purb A G 11: 6,475,702 V62A probably damaging Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Rtl1 C T 12: 109,591,371 E1345K unknown Het
Sema3e G A 5: 14,230,180 A358T probably damaging Het
Slc29a2 A G 19: 5,026,398 I105V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc6a5 G A 7: 49,941,825 V513I probably damaging Het
Slco4a1 T A 2: 180,474,114 F681Y possibly damaging Het
Sp1 A G 15: 102,431,010 N775S possibly damaging Het
Sspo T A 6: 48,455,671 V827D probably damaging Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tars2 A T 3: 95,750,416 C238S probably damaging Het
Tnks1bp1 C A 2: 85,062,834 P373Q probably benign Het
Tnpo3 A G 6: 29,575,046 L373P probably damaging Het
Unc45b A C 11: 82,915,072 D135A possibly damaging Het
Vmn1r235 A T 17: 21,261,415 M1L probably benign Het
Vmn2r66 T C 7: 85,007,941 I85M probably damaging Het
Vmn2r80 T G 10: 79,168,232 L93W probably benign Het
Vwf G T 6: 125,673,887 probably benign Het
Ythdf3 A G 3: 16,183,922 R9G probably damaging Het
Zfp229 A G 17: 21,745,036 probably null Het
Zfp958 A C 8: 4,625,838 probably null Het
Other mutations in Ncam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ncam1 APN 9 49523565 missense probably damaging 1.00
IGL01384:Ncam1 APN 9 49509852 missense possibly damaging 0.76
IGL01798:Ncam1 APN 9 49508607 missense probably damaging 1.00
IGL02239:Ncam1 APN 9 49567402 missense probably damaging 1.00
IGL02368:Ncam1 APN 9 49543083 nonsense probably null
IGL02616:Ncam1 APN 9 49508688 missense probably benign 0.23
PIT4431001:Ncam1 UTSW 9 49798693 missense probably benign 0.04
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0502:Ncam1 UTSW 9 49569818 unclassified probably benign
R0924:Ncam1 UTSW 9 49562176 intron probably benign
R1398:Ncam1 UTSW 9 49517589 intron probably benign
R1440:Ncam1 UTSW 9 49544800 missense probably damaging 1.00
R1491:Ncam1 UTSW 9 49505549 missense probably benign 0.15
R1676:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R1743:Ncam1 UTSW 9 49557145 missense probably damaging 1.00
R1769:Ncam1 UTSW 9 49545256 unclassified probably benign
R1951:Ncam1 UTSW 9 49545192 missense probably benign 0.36
R2143:Ncam1 UTSW 9 49543019 missense possibly damaging 0.87
R2167:Ncam1 UTSW 9 49568481 missense probably benign 0.42
R2170:Ncam1 UTSW 9 49798681 missense probably benign 0.06
R2290:Ncam1 UTSW 9 49523651 splice site probably benign
R2321:Ncam1 UTSW 9 49544832 unclassified probably benign
R3001:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R3002:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R4026:Ncam1 UTSW 9 49564995 missense probably benign 0.00
R4279:Ncam1 UTSW 9 49506959 intron probably benign
R4289:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R4873:Ncam1 UTSW 9 49507621 intron probably benign
R4875:Ncam1 UTSW 9 49507621 intron probably benign
R4883:Ncam1 UTSW 9 49541883 splice site probably null
R4899:Ncam1 UTSW 9 49545251 critical splice acceptor site probably null
R4923:Ncam1 UTSW 9 49505479 missense probably benign
R5041:Ncam1 UTSW 9 49566785 missense probably damaging 1.00
R5058:Ncam1 UTSW 9 49798695 missense probably benign 0.16
R5386:Ncam1 UTSW 9 49564874 missense probably damaging 1.00
R5388:Ncam1 UTSW 9 49544754 missense probably benign
R5598:Ncam1 UTSW 9 49545751 missense probably damaging 1.00
R5895:Ncam1 UTSW 9 49507043 missense probably benign
R5972:Ncam1 UTSW 9 49507529 missense possibly damaging 0.93
R6059:Ncam1 UTSW 9 49544666 missense probably damaging 1.00
R6226:Ncam1 UTSW 9 49565004 missense probably benign 0.00
R6392:Ncam1 UTSW 9 49523575 missense probably damaging 0.99
R6750:Ncam1 UTSW 9 49567339 missense probably damaging 1.00
R6799:Ncam1 UTSW 9 49508611 missense probably damaging 0.99
R7230:Ncam1 UTSW 9 49509823 missense probably benign 0.00
R7335:Ncam1 UTSW 9 49506911 missense
X0062:Ncam1 UTSW 9 49545601 nonsense probably null
X0064:Ncam1 UTSW 9 49566680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTGACAAGTCCCACCTTTTG -3'
(R):5'- CCATTGTGGGCATCCTCATTG -3'

Sequencing Primer
(F):5'- CCTTTTGACATCATCAGAAAGCTTC -3'
(R):5'- GTGGGCATCCTCATTGTCATC -3'
Posted On2016-11-08