Incidental Mutation 'R5513:Olfr12'
ID440150
Institutional Source Beutler Lab
Gene Symbol Olfr12
Ensembl Gene ENSMUSG00000061616
Gene Nameolfactory receptor 12
SynonymsGA_x6K02T2R7CC-81134096-81133095, MOR208-5
MMRRC Submission 043073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5513 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92617788-92623412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92620380 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 158 (V158A)
Ref Sequence ENSEMBL: ENSMUSP00000150858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081274] [ENSMUST00000213247]
Predicted Effect probably benign
Transcript: ENSMUST00000081274
AA Change: V158A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080027
Gene: ENSMUSG00000061616
AA Change: V158A

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:7tm_4 38 314 8e-53 PFAM
Pfam:7tm_1 48 297 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213247
AA Change: V158A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,750,973 V1130I probably damaging Het
Abtb2 A T 2: 103,709,278 probably null Het
Akr1b3 C A 6: 34,316,646 probably benign Het
Alppl2 T A 1: 87,087,338 N434Y probably benign Het
Ampd2 A G 3: 108,075,667 I648T possibly damaging Het
Ankrd11 T C 8: 122,892,520 E1510G probably benign Het
Ano2 A C 6: 126,039,322 K939N possibly damaging Het
Arhgef5 A G 6: 43,272,339 Y8C probably damaging Het
Aspm A T 1: 139,482,398 I2609F probably damaging Het
Camsap2 A T 1: 136,280,863 S964T probably benign Het
Cd22 C T 7: 30,867,025 R823Q probably damaging Het
Cd74 T C 18: 60,811,305 C196R probably damaging Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Cidec A T 6: 113,428,179 Y177N probably damaging Het
Crb1 C T 1: 139,236,821 probably null Het
Cts7 T C 13: 61,355,584 K189E possibly damaging Het
Cyp2c68 A T 19: 39,703,406 Y358N probably damaging Het
Dab2ip A T 2: 35,710,254 H294L probably benign Het
Dnah6 T C 6: 73,190,419 D502G probably null Het
Dnah8 T A 17: 30,752,916 M2768K probably damaging Het
Etl4 C A 2: 20,743,827 S405R probably damaging Het
Fsip2 G T 2: 82,950,908 L19F probably damaging Het
Fsip2 C G 2: 82,950,912 Q217E probably benign Het
Fsip2 T A 2: 82,985,198 N3758K possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Hivep2 A T 10: 14,132,673 K1672* probably null Het
Igkv2-137 G A 6: 67,556,014 G54S possibly damaging Het
Ints8 A G 4: 11,248,303 V105A possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Lrrc8b A G 5: 105,485,984 K774R probably damaging Het
Mcm4 T A 16: 15,630,514 Y393F probably benign Het
Mki67 A G 7: 135,707,750 L324P probably damaging Het
Olfr1428 A G 19: 12,109,381 L55P probably damaging Het
Olfr1441 G A 19: 12,422,683 V125I probably benign Het
Olfr665 A T 7: 104,881,499 H264L probably damaging Het
Pld4 A G 12: 112,762,554 E19G probably benign Het
Plvap T C 8: 71,511,529 E63G probably damaging Het
Ppig A G 2: 69,750,359 T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 143,135,893 probably benign Het
Rbm15b A G 9: 106,886,117 L284P probably benign Het
Rhbdl3 T C 11: 80,331,842 V239A probably damaging Het
Sae1 T C 7: 16,366,856 E197G probably benign Het
Sdhaf2 C T 19: 10,517,030 R105H probably damaging Het
Senp3 T C 11: 69,677,139 D425G probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc46a1 T C 11: 78,466,550 F143S probably benign Het
Tom1 T A 8: 75,057,220 N52K probably damaging Het
Vmn1r11 A T 6: 57,137,632 T94S probably damaging Het
Zfp236 A G 18: 82,658,022 I390T probably damaging Het
Zfp709 A T 8: 71,890,056 H443L probably damaging Het
Zfp960 C T 17: 17,087,734 P237S possibly damaging Het
Other mutations in Olfr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Olfr12 APN 1 92620199 missense possibly damaging 0.88
IGL01309:Olfr12 APN 1 92620335 missense probably damaging 1.00
IGL02025:Olfr12 APN 1 92620547 missense probably benign 0.00
IGL02517:Olfr12 APN 1 92620461 missense probably benign
IGL02837:Olfr12 UTSW 1 92620682 missense possibly damaging 0.73
R1394:Olfr12 UTSW 1 92620545 missense probably benign 0.02
R1395:Olfr12 UTSW 1 92620545 missense probably benign 0.02
R1590:Olfr12 UTSW 1 92620745 missense possibly damaging 0.64
R1778:Olfr12 UTSW 1 92620620 missense possibly damaging 0.94
R1924:Olfr12 UTSW 1 92620803 missense probably damaging 1.00
R2011:Olfr12 UTSW 1 92620749 missense probably benign 0.01
R3877:Olfr12 UTSW 1 92620083 missense probably damaging 1.00
R5286:Olfr12 UTSW 1 92620362 missense probably benign 0.38
R5727:Olfr12 UTSW 1 92620178 missense probably benign 0.00
R5905:Olfr12 UTSW 1 92620142 missense possibly damaging 0.49
R5921:Olfr12 UTSW 1 92620622 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCAGCTTTGAGGCTTGTGC -3'
(R):5'- ATGGTCACGGTGATGTAGC -3'

Sequencing Primer
(F):5'- GCTTGTGCCACTCAGTTCTTC -3'
(R):5'- ACAGCTAAGGTGGTGCTCAC -3'
Posted On2016-11-08