Incidental Mutation 'R5514:Bmi1'
ID440210
Institutional Source Beutler Lab
Gene Symbol Bmi1
Ensembl Gene ENSMUSG00000026739
Gene NameBmi1 polycomb ring finger oncogene
SynonymsBmi1, Bmi-1, Pcgf4
MMRRC Submission 043074-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location18677018-18686629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18681903 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 31 (I31T)
Ref Sequence ENSEMBL: ENSMUSP00000119331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028071] [ENSMUST00000051929] [ENSMUST00000134734] [ENSMUST00000147365] [ENSMUST00000150834] [ENSMUST00000156284]
Predicted Effect probably damaging
Transcript: ENSMUST00000028071
AA Change: I31T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028071
Gene: ENSMUSG00000026739
AA Change: I31T

DomainStartEndE-ValueType
RING 18 56 4.34e-5 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 264 276 N/A INTRINSIC
low complexity region 313 323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051929
AA Change: I31T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110300
Gene: ENSMUSG00000026739
AA Change: I31T

DomainStartEndE-ValueType
RING 18 56 4.34e-5 SMART
Pfam:RAWUL 142 224 1.5e-27 PFAM
low complexity region 264 276 N/A INTRINSIC
low complexity region 313 323 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132014
Predicted Effect probably damaging
Transcript: ENSMUST00000134734
AA Change: I31T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121876
Gene: ENSMUSG00000026739
AA Change: I31T

DomainStartEndE-ValueType
RING 18 56 4.34e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147365
AA Change: I31T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118273
Gene: ENSMUSG00000026739
AA Change: I31T

DomainStartEndE-ValueType
RING 18 56 4.34e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150834
AA Change: I31T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119331
Gene: ENSMUSG00000026739
AA Change: I31T

DomainStartEndE-ValueType
RING 18 56 4.34e-5 SMART
low complexity region 146 159 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156284
AA Change: I31T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118730
Gene: ENSMUSG00000026739
AA Change: I31T

DomainStartEndE-ValueType
RING 18 56 4.34e-5 SMART
low complexity region 146 159 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents naturally occurring read-through transcription between the neighboring COMM domain-containing protein 3 and polycomb complex protein BMI-1 genes on chromosome 10. The read-through transcript produces a fusion protein that shares sequence identity with each individual gene product. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants display decreased hematopoietic cell number, immune deficiency, neurological abnormalities, and posterior transformation, while transgenic overexpressing mice show an opposite dose-dependent anterior transformation of vertebral identity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Bmi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02133:Bmi1 APN 2 18683677 missense probably damaging 1.00
IGL02270:Bmi1 APN 2 18684458 missense probably benign 0.00
IGL02801:Bmi1 APN 2 18681881 missense probably damaging 1.00
IGL03265:Bmi1 APN 2 18681861 missense possibly damaging 0.53
PIT4280001:Bmi1 UTSW 2 18683009 nonsense probably null
PIT4434001:Bmi1 UTSW 2 18684231 missense probably benign 0.10
R0142:Bmi1 UTSW 2 18683284 critical splice donor site probably null
R0411:Bmi1 UTSW 2 18683172 splice site probably benign
R0504:Bmi1 UTSW 2 18684072 splice site probably null
R1926:Bmi1 UTSW 2 18682273 missense probably benign 0.02
R2070:Bmi1 UTSW 2 18684040 missense probably benign 0.01
R2238:Bmi1 UTSW 2 18683414 splice site probably benign
R2412:Bmi1 UTSW 2 18683714 missense probably damaging 1.00
R4915:Bmi1 UTSW 2 18682332 splice site probably benign
R6222:Bmi1 UTSW 2 18683702 missense possibly damaging 0.88
R6320:Bmi1 UTSW 2 18684375 missense probably benign 0.00
R6456:Bmi1 UTSW 2 18682247 missense probably damaging 1.00
R6757:Bmi1 UTSW 2 18684029 missense probably damaging 1.00
R7310:Bmi1 UTSW 2 18684419 missense probably benign
X0063:Bmi1 UTSW 2 18682223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGTGGAGATAACTCAATTCTCG -3'
(R):5'- AGGATGGGAAATGACTAGGTTTTCTC -3'

Sequencing Primer
(F):5'- GATCACTGAGCTAAATCCC -3'
(R):5'- CTTGAAAACTACATACTGCCTAACTG -3'
Posted On2016-11-08