Incidental Mutation 'R5514:Pde6b'
ID440228
Institutional Source Beutler Lab
Gene Symbol Pde6b
Ensembl Gene ENSMUSG00000029491
Gene Namephosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonymsrd10, Pdeb, rd, rd1, r
MMRRC Submission 043074-MU
Accession Numbers

Genbank: NM_008806; MGI: 97525

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108388391-108432397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108423451 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 423 (Q423H)
Ref Sequence ENSEMBL: ENSMUSP00000031456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031456]
Predicted Effect probably benign
Transcript: ENSMUST00000031456
AA Change: Q423H

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491
AA Change: Q423H

DomainStartEndE-ValueType
GAF 71 230 1.29e-27 SMART
GAF 252 439 5.76e-25 SMART
Blast:HDc 484 538 1e-24 BLAST
HDc 554 732 1.25e-9 SMART
Blast:HDc 757 792 8e-13 BLAST
low complexity region 813 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134865
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Pde6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pde6b APN 5 108426571 splice site probably benign
IGL01071:Pde6b APN 5 108419715 nonsense probably null
IGL01335:Pde6b APN 5 108423513 missense probably benign 0.03
IGL01611:Pde6b APN 5 108403396 missense possibly damaging 0.90
IGL01881:Pde6b APN 5 108421500 missense probably benign 0.01
IGL01941:Pde6b APN 5 108423036 missense probably benign 0.11
IGL02616:Pde6b APN 5 108431541 missense probably benign 0.05
IGL02657:Pde6b APN 5 108420276 splice site probably benign
IGL03217:Pde6b APN 5 108419566 missense probably damaging 1.00
Bemr28 UTSW 5 unclassified
D4043:Pde6b UTSW 5 108425356 nonsense probably null
N/A:Pde6b UTSW 5 108429103 unclassified probably benign
PIT4362001:Pde6b UTSW 5 108423585 critical splice donor site probably null
PIT4581001:Pde6b UTSW 5 108428508 missense probably benign 0.01
R0940:Pde6b UTSW 5 108420337 missense possibly damaging 0.95
R0963:Pde6b UTSW 5 108430668 missense probably benign
R1738:Pde6b UTSW 5 108430559 nonsense probably null
R1753:Pde6b UTSW 5 108388691 nonsense probably null
R1801:Pde6b UTSW 5 108427847 missense possibly damaging 0.51
R1913:Pde6b UTSW 5 108427190 missense probably benign 0.05
R2131:Pde6b UTSW 5 108428203 missense probably damaging 1.00
R2282:Pde6b UTSW 5 108423586 splice site probably null
R3713:Pde6b UTSW 5 108423062 missense probably damaging 1.00
R4385:Pde6b UTSW 5 108427642 missense probably benign 0.08
R4562:Pde6b UTSW 5 108403368 missense probably benign 0.23
R4582:Pde6b UTSW 5 108425231 critical splice acceptor site probably null
R4939:Pde6b UTSW 5 108421497 missense probably benign 0.01
R4950:Pde6b UTSW 5 108430703 missense probably benign 0.16
R4972:Pde6b UTSW 5 108425264 missense probably benign 0.00
R4983:Pde6b UTSW 5 108425330 missense probably benign 0.21
R5056:Pde6b UTSW 5 108423491 nonsense probably null
R5528:Pde6b UTSW 5 108423558 missense probably benign 0.04
R5937:Pde6b UTSW 5 108424327 missense probably benign 0.00
R6556:Pde6b UTSW 5 108421501 missense possibly damaging 0.56
R6826:Pde6b UTSW 5 108430592 nonsense probably null
R6884:Pde6b UTSW 5 108388708 missense probably damaging 0.99
R7213:Pde6b UTSW 5 108404090 missense probably damaging 1.00
R7444:Pde6b UTSW 5 108427142 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTGATTAGCACTACATCAGG -3'
(R):5'- ACAGTGTCTGGGTTGCACAG -3'

Sequencing Primer
(F):5'- CTGATTAGCACTACATCAGGGAGAAG -3'
(R):5'- AGGGTTAGACCTAGCCATTGG -3'
Posted On2016-11-08