Incidental Mutation 'R5514:Unc13a'
ID440238
Institutional Source Beutler Lab
Gene Symbol Unc13a
Ensembl Gene ENSMUSG00000034799
Gene Nameunc-13 homolog A (C. elegans)
Synonyms2410078G03Rik, Munc13-1
MMRRC Submission 043074-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71624417-71671757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71643151 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1241 (Y1241H)
Ref Sequence ENSEMBL: ENSMUSP00000135189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]
Predicted Effect probably damaging
Transcript: ENSMUST00000030170
AA Change: Y1241H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: Y1241H

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175909
Predicted Effect unknown
Transcript: ENSMUST00000176127
AA Change: Y150H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177032
Predicted Effect probably damaging
Transcript: ENSMUST00000177517
AA Change: Y1241H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: Y1241H

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.7e-53 PFAM
C2 1574 1680 5.03e-12 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Unc13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Unc13a APN 8 71643147 missense probably null 0.70
IGL01023:Unc13a APN 8 71661825 missense probably benign 0.02
IGL01456:Unc13a APN 8 71644567 missense probably damaging 1.00
IGL01820:Unc13a APN 8 71654947 missense probably damaging 0.99
IGL01909:Unc13a APN 8 71639210 splice site probably benign
IGL01925:Unc13a APN 8 71634543 missense possibly damaging 0.95
IGL02407:Unc13a APN 8 71648942 missense probably damaging 0.99
IGL02622:Unc13a APN 8 71652514 splice site probably null
IGL02634:Unc13a APN 8 71655701 missense probably benign 0.03
IGL02724:Unc13a APN 8 71656305 splice site probably benign
IGL02892:Unc13a APN 8 71649910 missense probably damaging 1.00
IGL02948:Unc13a APN 8 71650549 missense possibly damaging 0.63
IGL03081:Unc13a APN 8 71649549 missense probably damaging 0.98
IGL03372:Unc13a APN 8 71655709 missense probably damaging 1.00
curvy UTSW 8 71630504 splice site probably null
greed UTSW 8 71654845 missense probably damaging 1.00
largesse UTSW 8 71634658 missense probably damaging 1.00
serpiginous UTSW 8 71664245 missense probably damaging 1.00
PIT4469001:Unc13a UTSW 8 71658314 nonsense probably null
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0389:Unc13a UTSW 8 71658032 missense probably benign 0.01
R0457:Unc13a UTSW 8 71658001 critical splice donor site probably null
R0478:Unc13a UTSW 8 71651148 missense possibly damaging 0.92
R0483:Unc13a UTSW 8 71644913 missense probably damaging 0.96
R0609:Unc13a UTSW 8 71658467 missense probably damaging 0.96
R0611:Unc13a UTSW 8 71649865 missense probably damaging 1.00
R0730:Unc13a UTSW 8 71656285 missense possibly damaging 0.68
R0883:Unc13a UTSW 8 71642173 nonsense probably null
R1162:Unc13a UTSW 8 71647917 missense probably benign 0.31
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1196:Unc13a UTSW 8 71654986 missense probably damaging 1.00
R1400:Unc13a UTSW 8 71651221 missense probably damaging 1.00
R1446:Unc13a UTSW 8 71648981 missense possibly damaging 0.91
R1507:Unc13a UTSW 8 71658266 missense probably benign
R1636:Unc13a UTSW 8 71653390 missense probably damaging 1.00
R1858:Unc13a UTSW 8 71652399 missense probably damaging 1.00
R2025:Unc13a UTSW 8 71639768 missense possibly damaging 0.92
R2107:Unc13a UTSW 8 71656251 splice site probably null
R2286:Unc13a UTSW 8 71630559 missense probably damaging 1.00
R2334:Unc13a UTSW 8 71634558 missense probably damaging 1.00
R2924:Unc13a UTSW 8 71644952 missense possibly damaging 0.88
R3177:Unc13a UTSW 8 71629695 missense probably benign 0.01
R3277:Unc13a UTSW 8 71629695 missense probably benign 0.01
R4175:Unc13a UTSW 8 71667724 intron probably benign
R4279:Unc13a UTSW 8 71666667 missense probably damaging 0.98
R4629:Unc13a UTSW 8 71653453 missense possibly damaging 0.65
R4803:Unc13a UTSW 8 71662850 splice site probably null
R4877:Unc13a UTSW 8 71658616 missense possibly damaging 0.85
R4927:Unc13a UTSW 8 71654845 missense probably damaging 1.00
R4930:Unc13a UTSW 8 71630504 splice site probably null
R4994:Unc13a UTSW 8 71643172 missense probably benign 0.28
R5011:Unc13a UTSW 8 71641477 nonsense probably null
R5252:Unc13a UTSW 8 71652564 missense probably damaging 1.00
R5356:Unc13a UTSW 8 71662514 missense probably benign 0.02
R5458:Unc13a UTSW 8 71664245 missense probably damaging 1.00
R5784:Unc13a UTSW 8 71655666 missense possibly damaging 0.61
R5853:Unc13a UTSW 8 71655129 splice site probably null
R6183:Unc13a UTSW 8 71644666 missense probably damaging 1.00
R6277:Unc13a UTSW 8 71666639 critical splice donor site probably null
R6374:Unc13a UTSW 8 71641453 missense possibly damaging 0.70
R6392:Unc13a UTSW 8 71637809 missense possibly damaging 0.83
R6515:Unc13a UTSW 8 71647940 missense probably benign 0.44
R6576:Unc13a UTSW 8 71653478 missense probably benign 0.00
R6943:Unc13a UTSW 8 71652377 missense probably damaging 1.00
R7045:Unc13a UTSW 8 71658763 missense possibly damaging 0.95
R7062:Unc13a UTSW 8 71663237 missense probably benign 0.00
R7146:Unc13a UTSW 8 71630553 missense probably damaging 1.00
R7260:Unc13a UTSW 8 71660585 missense possibly damaging 0.71
R7443:Unc13a UTSW 8 71630959 missense probably damaging 0.98
Z1088:Unc13a UTSW 8 71654803 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGATTCATGTCCCTTCAGTG -3'
(R):5'- AAGCAATACTTCCATGGGGC -3'

Sequencing Primer
(F):5'- CATGTCCCTTCAGTGGAATTTG -3'
(R):5'- GGTCTCCTCTGGGTCCTAG -3'
Posted On2016-11-08