Incidental Mutation 'R5514:Sacm1l'
ID440243
Institutional Source Beutler Lab
Gene Symbol Sacm1l
Ensembl Gene ENSMUSG00000025240
Gene NameSAC1 suppressor of actin mutations 1-like (yeast)
SynonymsSAC1, Sac1p
MMRRC Submission 043074-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123529759-123592600 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 123586354 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 465 (R465*)
Ref Sequence ENSEMBL: ENSMUSP00000026270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026270] [ENSMUST00000026273]
Predicted Effect probably null
Transcript: ENSMUST00000026270
AA Change: R465*
SMART Domains Protein: ENSMUSP00000026270
Gene: ENSMUSG00000025240
AA Change: R465*

DomainStartEndE-ValueType
Pfam:Syja_N 58 346 4.7e-88 PFAM
low complexity region 400 415 N/A INTRINSIC
Blast:IPPc 416 500 3e-12 BLAST
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 550 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026273
SMART Domains Protein: ENSMUSP00000026273
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:SNF 48 624 5.4e-173 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217089
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is localized to the endoplasmic reticulum and golgi, and functions as a phosphoinositide lipid phosphatase. Studies in mammals suggest that this gene is involved in the organization of golgi membranes and the mitotic spindles. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Sacm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Sacm1l APN 9 123570549 missense possibly damaging 0.88
IGL02598:Sacm1l APN 9 123578996 missense probably benign 0.03
IGL02796:Sacm1l UTSW 9 123548924 missense possibly damaging 0.66
R0138:Sacm1l UTSW 9 123548917 missense probably benign 0.15
R0628:Sacm1l UTSW 9 123548995 splice site probably benign
R0847:Sacm1l UTSW 9 123548862 missense probably damaging 1.00
R1102:Sacm1l UTSW 9 123582298 missense probably damaging 0.98
R1159:Sacm1l UTSW 9 123566411 missense probably benign 0.06
R2898:Sacm1l UTSW 9 123560601 critical splice donor site probably null
R3001:Sacm1l UTSW 9 123585084 splice site probably benign
R3780:Sacm1l UTSW 9 123552790 missense probably benign 0.00
R3852:Sacm1l UTSW 9 123587576 missense probably damaging 1.00
R4731:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4732:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4733:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4894:Sacm1l UTSW 9 123582344 missense probably benign 0.17
R5021:Sacm1l UTSW 9 123582328 missense probably damaging 1.00
R5033:Sacm1l UTSW 9 123586399 missense probably damaging 1.00
R5075:Sacm1l UTSW 9 123582262 missense probably benign 0.00
R5135:Sacm1l UTSW 9 123577025 missense probably benign 0.00
R5284:Sacm1l UTSW 9 123586420 missense probably damaging 0.99
R5629:Sacm1l UTSW 9 123566399 missense probably benign
R6137:Sacm1l UTSW 9 123569005 missense probably damaging 1.00
R6266:Sacm1l UTSW 9 123542420 missense probably damaging 1.00
R7079:Sacm1l UTSW 9 123569997 missense probably damaging 1.00
R7147:Sacm1l UTSW 9 123568951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGGCTGTACTTCTTTTCATAG -3'
(R):5'- TGAAGCTGTGAACTTTCCAAAC -3'

Sequencing Primer
(F):5'- GGTTGTATCTATGGATTCAGCCAACC -3'
(R):5'- GCTGTGAACTTTCCAAACTTAATTTG -3'
Posted On2016-11-08