Incidental Mutation 'R5514:Ppp1r1b'
ID440250
Institutional Source Beutler Lab
Gene Symbol Ppp1r1b
Ensembl Gene ENSMUSG00000061718
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 1B
SynonymsDARPP-32, Darpp32
MMRRC Submission 043074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98348404-98357796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98355402 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 70 (L70P)
Ref Sequence ENSEMBL: ENSMUSP00000123528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018311] [ENSMUST00000078694] [ENSMUST00000137634] [ENSMUST00000150762]
Predicted Effect probably benign
Transcript: ENSMUST00000018311
SMART Domains Protein: ENSMUSP00000018311
Gene: ENSMUSG00000018167

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Pfam:MENTAL 48 214 1.1e-65 PFAM
START 240 445 4.43e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078694
AA Change: L106P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077760
Gene: ENSMUSG00000061718
AA Change: L106P

DomainStartEndE-ValueType
Pfam:DARPP-32 2 183 6.8e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133700
Predicted Effect probably damaging
Transcript: ENSMUST00000137634
AA Change: L70P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123528
Gene: ENSMUSG00000061718
AA Change: L70P

DomainStartEndE-ValueType
Pfam:DARPP-32 1 143 7.4e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147415
Predicted Effect probably damaging
Transcript: ENSMUST00000150762
AA Change: L70P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121147
Gene: ENSMUSG00000061718
AA Change: L70P

DomainStartEndE-ValueType
Pfam:DARPP-32 1 143 7.4e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155063
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a bifunctional signal transduction molecule. Dopaminergic and glutamatergic receptor stimulation regulates its phosphorylation and function as a kinase or phosphatase inhibitor. As a target for dopamine, this gene may serve as a therapeutic target for neurologic and psychiatric disorders in humans. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated substance P-like immunoreactivity and deficits in responses to dopamine, cocaine, ethanol, and antipsychotic drugs. Abnormalities in striatal function were also noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Ppp1r1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Ppp1r1b APN 11 98350566 splice site probably null
IGL01979:Ppp1r1b APN 11 98356840 missense probably damaging 0.99
IGL02455:Ppp1r1b APN 11 98350569 missense probably damaging 1.00
IGL02818:Ppp1r1b APN 11 98351270 missense possibly damaging 0.92
R1965:Ppp1r1b UTSW 11 98355363 missense probably damaging 1.00
R2858:Ppp1r1b UTSW 11 98355319 splice site probably benign
R4893:Ppp1r1b UTSW 11 98355344 missense possibly damaging 0.69
R6315:Ppp1r1b UTSW 11 98355390 missense probably damaging 1.00
R6813:Ppp1r1b UTSW 11 98349176 critical splice donor site probably null
R7426:Ppp1r1b UTSW 11 98355479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACCCTCTGTAGAGTGGATG -3'
(R):5'- AGGATCCTTCTGGAAGAGCC -3'

Sequencing Primer
(F):5'- TCACCATTGGACTTGGGC -3'
(R):5'- GATCCTTCTGGAAGAGCCACCAC -3'
Posted On2016-11-08