Incidental Mutation 'R5514:Nid2'
ID440259
Institutional Source Beutler Lab
Gene Symbol Nid2
Ensembl Gene ENSMUSG00000021806
Gene Namenidogen 2
Synonymsentactin 2, entactin-2
MMRRC Submission 043074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location19751265-19811787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19802467 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1081 (Q1081L)
Ref Sequence ENSEMBL: ENSMUSP00000022340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022340]
Predicted Effect probably damaging
Transcript: ENSMUST00000022340
AA Change: Q1081L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022340
Gene: ENSMUSG00000021806
AA Change: Q1081L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Blast:NIDO 39 77 3e-11 BLAST
NIDO 108 276 1.12e-72 SMART
low complexity region 421 430 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
EGF 510 547 1.84e1 SMART
G2F 548 780 4.36e-143 SMART
EGF 785 823 2.52e-2 SMART
EGF_CA 824 866 1.45e-11 SMART
EGF 874 914 3.15e-3 SMART
EGF_CA 915 953 5.03e-11 SMART
TY 988 1037 8.27e-20 SMART
TY 1068 1116 1.19e-20 SMART
LY 1162 1204 1.15e-5 SMART
LY 1206 1248 8.82e-16 SMART
LY 1249 1293 1.51e-14 SMART
LY 1294 1336 3.56e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224057
Predicted Effect possibly damaging
Transcript: ENSMUST00000224263
AA Change: Q815L

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225791
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null alleleexhibit calcification of joint cartilage and osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Nid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Nid2 APN 14 19768677 missense probably benign
IGL01788:Nid2 APN 14 19807979 missense probably damaging 1.00
IGL02259:Nid2 APN 14 19768209 critical splice acceptor site probably null
IGL03084:Nid2 APN 14 19768932 missense probably benign 0.05
IGL03247:Nid2 APN 14 19779620 missense probably damaging 1.00
IGL03098:Nid2 UTSW 14 19805938 missense probably damaging 0.99
PIT4810001:Nid2 UTSW 14 19810090 missense possibly damaging 0.82
R0173:Nid2 UTSW 14 19802332 splice site probably benign
R0501:Nid2 UTSW 14 19789668 splice site probably null
R1117:Nid2 UTSW 14 19763664 critical splice acceptor site probably null
R1305:Nid2 UTSW 14 19768862 missense probably benign 0.00
R1572:Nid2 UTSW 14 19805412 missense probably benign 0.08
R1594:Nid2 UTSW 14 19781261 missense probably benign 0.03
R1789:Nid2 UTSW 14 19752431 missense possibly damaging 0.95
R1927:Nid2 UTSW 14 19768276 missense probably damaging 1.00
R2085:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2086:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2100:Nid2 UTSW 14 19778878 nonsense probably null
R2158:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2240:Nid2 UTSW 14 19805914 missense probably damaging 0.99
R2314:Nid2 UTSW 14 19789761 missense probably benign 0.01
R2863:Nid2 UTSW 14 19768403 missense possibly damaging 0.92
R3113:Nid2 UTSW 14 19778043 missense probably benign 0.12
R3545:Nid2 UTSW 14 19763711 missense probably damaging 1.00
R3548:Nid2 UTSW 14 19763711 missense probably damaging 1.00
R3801:Nid2 UTSW 14 19809997 missense probably damaging 1.00
R4618:Nid2 UTSW 14 19808010 missense probably damaging 0.99
R4798:Nid2 UTSW 14 19789761 missense probably benign 0.01
R4953:Nid2 UTSW 14 19778078 nonsense probably null
R5256:Nid2 UTSW 14 19768208 critical splice acceptor site probably null
R5289:Nid2 UTSW 14 19805311 missense possibly damaging 0.95
R5302:Nid2 UTSW 14 19779701 missense probably benign
R5409:Nid2 UTSW 14 19805962 missense probably damaging 1.00
R6134:Nid2 UTSW 14 19778783 missense probably damaging 1.00
R6365:Nid2 UTSW 14 19803133 missense probably damaging 1.00
R6647:Nid2 UTSW 14 19802416 missense probably benign 0.04
R6758:Nid2 UTSW 14 19802483 missense probably damaging 1.00
R6882:Nid2 UTSW 14 19789707 missense probably damaging 1.00
R6893:Nid2 UTSW 14 19789787 missense probably benign 0.34
R7045:Nid2 UTSW 14 19779681 missense possibly damaging 0.94
R7392:Nid2 UTSW 14 19768656 missense probably benign 0.00
R7477:Nid2 UTSW 14 19805973 missense probably benign 0.09
X0009:Nid2 UTSW 14 19802511 missense probably damaging 1.00
X0021:Nid2 UTSW 14 19768862 missense probably benign 0.00
X0026:Nid2 UTSW 14 19778131 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTGATCTTGATTGGCCATCC -3'
(R):5'- TCCAGATTGGGATCCTGAGATAC -3'

Sequencing Primer
(F):5'- CAAGGTTTTGTTTCTCCATCTTAGAG -3'
(R):5'- GTCAACCCAGCATATTGATGAG -3'
Posted On2016-11-08