Incidental Mutation 'R5610:Zfp180'
ID440299
Institutional Source Beutler Lab
Gene Symbol Zfp180
Ensembl Gene ENSMUSG00000057101
Gene Namezinc finger protein 180
SynonymsHHZ168, 2310040I01Rik, D130011P11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R5610 (G1)
Quality Score129
Status Not validated
Chromosome7
Chromosomal Location24081924-24107713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24104890 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 245 (V245F)
Ref Sequence ENSEMBL: ENSMUSP00000064611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068975] [ENSMUST00000203854] [ENSMUST00000206184] [ENSMUST00000207002]
Predicted Effect probably benign
Transcript: ENSMUST00000068975
AA Change: V245F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000064611
Gene: ENSMUSG00000057101
AA Change: V245F

DomainStartEndE-ValueType
Blast:KRAB 46 103 7e-14 BLAST
ZnF_C2H2 318 340 3.21e-4 SMART
ZnF_C2H2 346 368 3.39e-3 SMART
ZnF_C2H2 374 396 1.72e-4 SMART
ZnF_C2H2 402 424 4.87e-4 SMART
ZnF_C2H2 430 452 1.58e-3 SMART
ZnF_C2H2 458 480 5.99e-4 SMART
ZnF_C2H2 486 508 2.12e-4 SMART
ZnF_C2H2 514 536 1.6e-4 SMART
ZnF_C2H2 542 564 3.95e-4 SMART
ZnF_C2H2 570 592 5.9e-3 SMART
ZnF_C2H2 598 620 1.12e-3 SMART
ZnF_C2H2 626 648 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203854
SMART Domains Protein: ENSMUSP00000145165
Gene: ENSMUSG00000057101

DomainStartEndE-ValueType
Blast:KRAB 12 69 4e-14 BLAST
ZnF_C2H2 284 306 3.21e-4 SMART
ZnF_C2H2 312 334 3.39e-3 SMART
ZnF_C2H2 340 362 1.72e-4 SMART
ZnF_C2H2 368 390 4.87e-4 SMART
ZnF_C2H2 396 418 1.58e-3 SMART
ZnF_C2H2 424 446 5.99e-4 SMART
ZnF_C2H2 452 474 2.12e-4 SMART
ZnF_C2H2 480 502 1.6e-4 SMART
ZnF_C2H2 508 530 3.95e-4 SMART
ZnF_C2H2 536 558 5.9e-3 SMART
ZnF_C2H2 564 586 1.12e-3 SMART
ZnF_C2H2 592 614 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206482
Predicted Effect probably benign
Transcript: ENSMUST00000207002
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See MIM 604749 for additional information on zinc finger proteins.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,931,019 V318I probably benign Het
1700018F24Rik A G 5: 145,045,346 D247G possibly damaging Het
1700123K08Rik A G 5: 138,564,141 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Accsl C A 2: 93,861,773 probably null Het
Adad2 C T 8: 119,614,761 R171C probably benign Het
Adgrv1 A C 13: 81,521,117 L2440R probably damaging Het
Antxr1 A G 6: 87,255,863 V239A probably damaging Het
Arhgap28 G A 17: 67,896,240 Q73* probably null Het
Arrdc5 C T 17: 56,297,846 R147H probably benign Het
Ash1l T C 3: 89,023,185 Y1990H probably damaging Het
Bank1 T C 3: 136,066,387 E494G probably damaging Het
Bicral A T 17: 46,808,492 I701N probably damaging Het
Bod1l T C 5: 41,821,874 Y699C probably damaging Het
C3ar1 T G 6: 122,850,578 T227P probably benign Het
Ccr3 C A 9: 124,029,481 D284E probably damaging Het
Cdh13 T C 8: 118,851,723 V163A possibly damaging Het
CK137956 C T 4: 127,946,647 probably null Het
Cltc T C 11: 86,721,646 S529G probably benign Het
Ddx11 A G 17: 66,150,026 K783E probably damaging Het
Dnah3 T A 7: 119,939,065 probably null Het
Eef2k A G 7: 120,886,782 H408R probably benign Het
Esr1 A G 10: 5,001,221 K533R probably damaging Het
Fat1 T A 8: 44,953,072 Y953* probably null Het
Fosl1 T A 19: 5,455,105 probably null Het
Frmd4b A G 6: 97,306,791 M373T probably benign Het
Gm1968 A G 16: 29,958,739 noncoding transcript Het
Gpr26 T C 7: 131,966,965 V13A possibly damaging Het
Gtf3c1 T C 7: 125,703,945 N106S possibly damaging Het
Itgb8 T G 12: 119,170,694 E546A probably damaging Het
Itpr3 C T 17: 27,118,566 T2450M probably benign Het
Kif1a A T 1: 93,025,728 Y1245N probably damaging Het
Klrb1f G A 6: 129,054,372 probably null Het
Lars A G 18: 42,257,091 L37P probably benign Het
Lnpk T C 2: 74,548,025 T131A probably benign Het
Mob3c C T 4: 115,833,681 T156I probably benign Het
Nadk T A 4: 155,584,171 W100R probably damaging Het
Npy6r A T 18: 44,275,994 I161F probably benign Het
Olfr1212 A C 2: 88,958,826 D120A probably damaging Het
Olfr773 G A 10: 129,186,557 T288I probably damaging Het
Pcdhga3 A G 18: 37,675,223 E243G possibly damaging Het
Pdss2 A G 10: 43,439,832 T361A probably benign Het
Pkd1l2 G T 8: 117,042,320 Q1198K probably benign Het
Prdx1 T A 4: 116,692,927 I102N probably damaging Het
Prss1 G A 6: 41,461,213 V25I probably benign Het
Pspc1 A G 14: 56,777,931 Y77H probably damaging Het
Rnf5 T C 17: 34,601,738 probably benign Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Ryr1 C A 7: 29,111,974 M235I probably benign Het
Sec24c A G 14: 20,691,825 Y776C probably damaging Het
Sharpin A G 15: 76,350,053 probably null Het
Slc12a4 C A 8: 105,950,213 V482L possibly damaging Het
Slc38a1 C T 15: 96,616,141 probably null Het
Smtn G T 11: 3,529,582 T495N probably damaging Het
Sncaip A G 18: 52,868,919 T171A probably benign Het
Sprr2e T C 3: 92,353,092 *77R probably null Het
Syngap1 T A 17: 26,959,780 D443E possibly damaging Het
Taldo1 T C 7: 141,392,292 V24A probably damaging Het
Tfap2c T A 2: 172,549,858 N8K probably benign Het
Tmem229a T C 6: 24,955,581 Y58C probably damaging Het
Tubgcp3 T C 8: 12,639,577 Y563C probably damaging Het
Ubr1 T A 2: 120,892,112 D1342V probably benign Het
Usp7 C T 16: 8,716,510 probably null Het
Wbp1 C T 6: 83,120,235 G75D probably damaging Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp646 T A 7: 127,879,358 C236S probably damaging Het
Other mutations in Zfp180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Zfp180 APN 7 24085469 missense probably damaging 0.98
IGL00990:Zfp180 APN 7 24104830 missense probably benign 0.42
IGL00990:Zfp180 APN 7 24104995 missense possibly damaging 0.60
IGL00990:Zfp180 APN 7 24104416 missense possibly damaging 0.83
IGL01061:Zfp180 APN 7 24104745 missense possibly damaging 0.50
IGL01328:Zfp180 APN 7 24101479 missense probably benign 0.01
IGL03134:Zfp180 UTSW 7 24104745 missense possibly damaging 0.50
R0137:Zfp180 UTSW 7 24105733 missense possibly damaging 0.93
R0390:Zfp180 UTSW 7 24104707 missense possibly damaging 0.95
R1451:Zfp180 UTSW 7 24105218 missense probably benign 0.00
R1534:Zfp180 UTSW 7 24101523 missense probably benign 0.31
R1555:Zfp180 UTSW 7 24101574 intron probably benign
R1577:Zfp180 UTSW 7 24105908 missense probably damaging 1.00
R1605:Zfp180 UTSW 7 24104624 missense probably benign 0.00
R1633:Zfp180 UTSW 7 24104801 missense probably benign 0.07
R1817:Zfp180 UTSW 7 24105227 missense probably damaging 1.00
R2012:Zfp180 UTSW 7 24104518 missense probably benign 0.01
R2076:Zfp180 UTSW 7 24105103 missense probably damaging 1.00
R2151:Zfp180 UTSW 7 24105260 missense probably damaging 1.00
R2262:Zfp180 UTSW 7 24104624 missense probably benign 0.32
R3081:Zfp180 UTSW 7 24105503 missense probably damaging 1.00
R3402:Zfp180 UTSW 7 24105745 missense probably benign 0.30
R4551:Zfp180 UTSW 7 24104573 missense possibly damaging 0.87
R4747:Zfp180 UTSW 7 24105821 missense probably damaging 1.00
R4983:Zfp180 UTSW 7 24106078 missense probably damaging 0.98
R5764:Zfp180 UTSW 7 24101484 missense possibly damaging 0.71
R5987:Zfp180 UTSW 7 24105434 missense probably damaging 1.00
R6207:Zfp180 UTSW 7 24105085 nonsense probably null
R6247:Zfp180 UTSW 7 24105105 missense probably damaging 1.00
R6328:Zfp180 UTSW 7 24105556 missense probably damaging 1.00
R6708:Zfp180 UTSW 7 24106096 missense probably damaging 0.98
R6814:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R6872:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R7006:Zfp180 UTSW 7 24105112 nonsense probably null
R7084:Zfp180 UTSW 7 24105261 missense probably damaging 1.00
R7101:Zfp180 UTSW 7 24104533 missense probably benign 0.00
R7213:Zfp180 UTSW 7 24104513 missense possibly damaging 0.87
R7263:Zfp180 UTSW 7 24105700 nonsense probably null
R7360:Zfp180 UTSW 7 24105490 missense probably damaging 1.00
R7487:Zfp180 UTSW 7 24106100 missense probably damaging 1.00
V5622:Zfp180 UTSW 7 24082031 start gained probably benign
X0067:Zfp180 UTSW 7 24105472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCCATAAACAGGCGTCACATG -3'
(R):5'- TCCTCAGAGTAGTTTCTCAGGC -3'

Sequencing Primer
(F):5'- CAGGCGTCACATGTTAAAAAGTTGC -3'
(R):5'- TCTGAGGAAGAGACGGACTTG -3'
Posted On2016-11-08