Mutagenetix > Incidental Mutation

Incidental Mutation 'V7732:Clcn6'

44031

Institutional Source

Beutler Lab

Gene Symbol

Clcn6

Ensembl Gene

ENSMUSG00000029016

Gene Name

chloride channel, voltage-sensitive 6

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

V7732 () of strain may

Quality Score

129

Status

Validated (trace)

Chromosome

Chromosomal Location

148088716-148123270 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 148098412 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 534 (V534A)

Ref Sequence

ENSEMBL: ENSMUSP00000030879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000137724]

AlphaFold

O35454

Predicted Effect

probably damaging
Transcript: ENSMUST00000030879
AA Change: V534A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: V534A

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	138	571	5.5e-98	PFAM
CBS	609	658	1.68e-3	SMART
CBS	811	859	1.34e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105711
AA Change: V537A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016
AA Change: V537A

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.5e-98	PFAM
CBS	612	661	1.68e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137724
AA Change: V537A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: V537A

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.9e-101	PFAM
CBS	612	661	1.68e-3	SMART
CBS	814	862	1.34e-11	SMART

Meta Mutation Damage Score

0.5021

Coding Region Coverage

1x: 98.2%
3x: 97.1%
10x: 94.9%
20x: 90.3%

Validation Efficiency

96% (25/26)

MGI Phenotype

FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy5	T	C	16: 35,103,911 (GRCm39)	F793L	probably benign	Het
Atmin	C	T	8: 117,683,218 (GRCm39)	P293S	probably damaging	Het
Card11	G	A	5: 140,862,250 (GRCm39)	R1016*	probably null	Het
Cep89	A	G	7: 35,102,523 (GRCm39)	S79G	probably damaging	Het
Cic	T	C	7: 24,991,670 (GRCm39)	V2227A	probably benign	Het
Dpep2	T	A	8: 106,715,892 (GRCm39)	H124L	probably damaging	Het
Elfn1	G	A	5: 139,957,194 (GRCm39)	R66Q	probably damaging	Het
Fanca	G	A	8: 124,031,020 (GRCm39)		probably benign	Het
Ggh	T	A	4: 20,046,225 (GRCm39)	F44L	probably benign	Het
Gpr37	T	C	6: 25,669,122 (GRCm39)	Y574C	probably benign	Het
Heatr5a	C	A	12: 51,952,107 (GRCm39)	A1178S	possibly damaging	Het
Igsf9	A	G	1: 172,317,960 (GRCm39)	T106A	probably benign	Het
Itpr3	G	C	17: 27,330,000 (GRCm39)		probably null	Het
Itpr3	G	T	17: 27,329,998 (GRCm39)		probably benign	Het
Nlrp6	G	A	7: 140,506,561 (GRCm39)		probably benign	Het
Rabac1	T	A	7: 24,671,644 (GRCm39)	Q51L	probably damaging	Het
Rgma	A	G	7: 73,067,068 (GRCm39)	T108A	probably damaging	Het
Rps24	A	G	14: 24,541,830 (GRCm39)	T6A	probably damaging	Het
Sarm1	T	A	11: 78,378,891 (GRCm39)	T385S	probably benign	Het
Spata17	T	C	1: 186,780,677 (GRCm39)	T357A	possibly damaging	Het
Ufl1	T	C	4: 25,251,368 (GRCm39)	I711V	probably damaging	Het
Vwa3a	A	G	7: 120,378,172 (GRCm39)		probably benign	Het

Other mutations in Clcn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Clcn6	APN	4	148,102,359 (GRCm39)	critical splice donor site	probably null
IGL00434:Clcn6	APN	4	148,098,195 (GRCm39)	missense	probably damaging	1.00
IGL00973:Clcn6	APN	4	148,098,245 (GRCm39)	splice site	probably benign
IGL01384:Clcn6	APN	4	148,103,423 (GRCm39)	missense	probably damaging	1.00
IGL01465:Clcn6	APN	4	148,105,908 (GRCm39)	splice site	probably benign
IGL01522:Clcn6	APN	4	148,101,992 (GRCm39)	missense	probably benign	0.44
R0194:Clcn6	UTSW	4	148,097,213 (GRCm39)	missense	probably damaging	1.00
R0280:Clcn6	UTSW	4	148,093,172 (GRCm39)	missense	probably damaging	1.00
R0349:Clcn6	UTSW	4	148,108,651 (GRCm39)	missense	possibly damaging	0.89
R0352:Clcn6	UTSW	4	148,099,063 (GRCm39)	missense	probably damaging	1.00
R0586:Clcn6	UTSW	4	148,123,206 (GRCm39)	unclassified	probably benign
R0927:Clcn6	UTSW	4	148,113,849 (GRCm39)	missense	probably benign	0.30
R1141:Clcn6	UTSW	4	148,098,356 (GRCm39)	missense	probably damaging	0.99
R1465:Clcn6	UTSW	4	148,098,358 (GRCm39)	missense	probably damaging	1.00
R1465:Clcn6	UTSW	4	148,098,358 (GRCm39)	missense	probably damaging	1.00
R1473:Clcn6	UTSW	4	148,108,613 (GRCm39)	missense	possibly damaging	0.93
R1551:Clcn6	UTSW	4	148,097,235 (GRCm39)	missense	possibly damaging	0.74
R1571:Clcn6	UTSW	4	148,097,226 (GRCm39)	missense	possibly damaging	0.63
R1593:Clcn6	UTSW	4	148,099,051 (GRCm39)	missense	probably benign
R1596:Clcn6	UTSW	4	148,107,836 (GRCm39)	missense	probably damaging	1.00
R1706:Clcn6	UTSW	4	148,102,025 (GRCm39)	missense	probably benign	0.00
R1769:Clcn6	UTSW	4	148,098,758 (GRCm39)	splice site	probably null
R2021:Clcn6	UTSW	4	148,095,109 (GRCm39)	critical splice donor site	probably null
R2022:Clcn6	UTSW	4	148,095,109 (GRCm39)	critical splice donor site	probably null
R2049:Clcn6	UTSW	4	148,108,594 (GRCm39)	missense	possibly damaging	0.88
R2081:Clcn6	UTSW	4	148,095,525 (GRCm39)	missense	probably damaging	1.00
R2140:Clcn6	UTSW	4	148,108,594 (GRCm39)	missense	possibly damaging	0.88
R2141:Clcn6	UTSW	4	148,108,594 (GRCm39)	missense	possibly damaging	0.88
R2142:Clcn6	UTSW	4	148,108,594 (GRCm39)	missense	possibly damaging	0.88
R2177:Clcn6	UTSW	4	148,099,057 (GRCm39)	missense	possibly damaging	0.73
R2511:Clcn6	UTSW	4	148,101,951 (GRCm39)	critical splice donor site	probably null
R2891:Clcn6	UTSW	4	148,097,073 (GRCm39)	critical splice donor site	probably null
R3750:Clcn6	UTSW	4	148,108,644 (GRCm39)	nonsense	probably null
R4014:Clcn6	UTSW	4	148,102,067 (GRCm39)	missense	probably damaging	0.98
R4023:Clcn6	UTSW	4	148,098,740 (GRCm39)	missense	possibly damaging	0.91
R4024:Clcn6	UTSW	4	148,098,740 (GRCm39)	missense	possibly damaging	0.91
R4025:Clcn6	UTSW	4	148,098,740 (GRCm39)	missense	possibly damaging	0.91
R4667:Clcn6	UTSW	4	148,108,624 (GRCm39)	missense	possibly damaging	0.61
R4865:Clcn6	UTSW	4	148,104,223 (GRCm39)	missense	probably damaging	1.00
R4978:Clcn6	UTSW	4	148,093,227 (GRCm39)	missense	probably benign	0.05
R5140:Clcn6	UTSW	4	148,122,774 (GRCm39)	unclassified	probably benign
R5345:Clcn6	UTSW	4	148,123,206 (GRCm39)	unclassified	probably benign
R5467:Clcn6	UTSW	4	148,102,093 (GRCm39)	missense	possibly damaging	0.81
R5665:Clcn6	UTSW	4	148,099,018 (GRCm39)	missense	possibly damaging	0.71
R5739:Clcn6	UTSW	4	148,098,646 (GRCm39)	missense	probably damaging	1.00
R5899:Clcn6	UTSW	4	148,102,049 (GRCm39)	missense	probably benign	0.01
R6043:Clcn6	UTSW	4	148,093,245 (GRCm39)	missense	probably damaging	1.00
R6351:Clcn6	UTSW	4	148,101,957 (GRCm39)	missense	probably benign	0.01
R6593:Clcn6	UTSW	4	148,095,226 (GRCm39)	missense	probably benign	0.21
R7440:Clcn6	UTSW	4	148,098,652 (GRCm39)	missense	probably damaging	1.00
R7674:Clcn6	UTSW	4	148,097,151 (GRCm39)	missense	probably damaging	1.00
R7756:Clcn6	UTSW	4	148,113,896 (GRCm39)	missense	probably damaging	1.00
R7901:Clcn6	UTSW	4	148,095,202 (GRCm39)	missense	probably damaging	1.00
R8559:Clcn6	UTSW	4	148,111,032 (GRCm39)	missense	possibly damaging	0.88
R8747:Clcn6	UTSW	4	148,093,354 (GRCm39)	critical splice donor site	probably null
R9246:Clcn6	UTSW	4	148,113,866 (GRCm39)	missense	probably benign	0.25
R9343:Clcn6	UTSW	4	148,098,458 (GRCm39)	missense	probably benign	0.03
Z1177:Clcn6	UTSW	4	148,107,827 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCTTGTTGAACAAGTCTCCAGTCC -3'
(R):5'- CCAATGTCCTGAAAAGGTAGTGCGG -3'

Sequencing Primer
(F):5'- AAGTCTCCAGTCCACTTGGC -3'
(R):5'- GTAGTGCGGATTTAATGAGTACAC -3'

Posted On

2013-05-31