Incidental Mutation 'V7732:Card11'
ID 44033
Institutional Source Beutler Lab
Gene Symbol Card11
Ensembl Gene ENSMUSG00000036526
Gene Name caspase recruitment domain family, member 11
Synonyms 2410011D02Rik, BIMP3, CARMA1, 0610008L17Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # V7732 () of strain may
Quality Score 225
Status Validated (trace)
Chromosome 5
Chromosomal Location 140858745-140986337 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 140862250 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1016 (R1016*)
Ref Sequence ENSEMBL: ENSMUSP00000082941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085786]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000085786
AA Change: R1016*
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: R1016*

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196169
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.9%
  • 20x: 90.3%
Validation Efficiency 96% (25/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,103,911 (GRCm39) F793L probably benign Het
Atmin C T 8: 117,683,218 (GRCm39) P293S probably damaging Het
Cep89 A G 7: 35,102,523 (GRCm39) S79G probably damaging Het
Cic T C 7: 24,991,670 (GRCm39) V2227A probably benign Het
Clcn6 A G 4: 148,098,412 (GRCm39) V534A probably damaging Het
Dpep2 T A 8: 106,715,892 (GRCm39) H124L probably damaging Het
Elfn1 G A 5: 139,957,194 (GRCm39) R66Q probably damaging Het
Fanca G A 8: 124,031,020 (GRCm39) probably benign Het
Ggh T A 4: 20,046,225 (GRCm39) F44L probably benign Het
Gpr37 T C 6: 25,669,122 (GRCm39) Y574C probably benign Het
Heatr5a C A 12: 51,952,107 (GRCm39) A1178S possibly damaging Het
Igsf9 A G 1: 172,317,960 (GRCm39) T106A probably benign Het
Itpr3 G C 17: 27,330,000 (GRCm39) probably null Het
Itpr3 G T 17: 27,329,998 (GRCm39) probably benign Het
Nlrp6 G A 7: 140,506,561 (GRCm39) probably benign Het
Rabac1 T A 7: 24,671,644 (GRCm39) Q51L probably damaging Het
Rgma A G 7: 73,067,068 (GRCm39) T108A probably damaging Het
Rps24 A G 14: 24,541,830 (GRCm39) T6A probably damaging Het
Sarm1 T A 11: 78,378,891 (GRCm39) T385S probably benign Het
Spata17 T C 1: 186,780,677 (GRCm39) T357A possibly damaging Het
Ufl1 T C 4: 25,251,368 (GRCm39) I711V probably damaging Het
Vwa3a A G 7: 120,378,172 (GRCm39) probably benign Het
Other mutations in Card11
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140,897,997 (GRCm38) intron probably benign
IGL00961:Card11 APN 5 140,885,464 (GRCm39) missense probably damaging 0.97
IGL01645:Card11 APN 5 140,863,778 (GRCm39) missense probably benign 0.00
IGL01731:Card11 APN 5 140,868,057 (GRCm39) missense possibly damaging 0.89
IGL01782:Card11 APN 5 140,913,481 (GRCm39) start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140,869,301 (GRCm39) missense possibly damaging 0.62
IGL01991:Card11 APN 5 140,899,133 (GRCm39) missense possibly damaging 0.63
IGL02447:Card11 APN 5 140,892,679 (GRCm39) missense possibly damaging 0.93
IGL02583:Card11 APN 5 140,863,881 (GRCm39) missense probably benign 0.10
IGL03255:Card11 APN 5 140,884,086 (GRCm39) missense possibly damaging 0.73
Ace UTSW 5 140,888,632 (GRCm39) missense possibly damaging 0.70
Caravaggio UTSW 5 140,899,064 (GRCm39) missense probably damaging 1.00
Dealer UTSW 5 140,871,632 (GRCm39) missense probably damaging 1.00
Dogs UTSW 5 140,867,755 (GRCm39) critical splice donor site probably null
Face UTSW 5 140,886,732 (GRCm39) missense probably damaging 1.00
hubei UTSW 5 140,892,522 (GRCm39) missense probably damaging 0.96
king UTSW 5 140,876,835 (GRCm39) splice site probably benign
may UTSW 5 140,862,250 (GRCm39) nonsense probably null
Poker UTSW 5 140,863,837 (GRCm39) missense probably benign
Sharp UTSW 5 140,862,180 (GRCm39) missense possibly damaging 0.93
Tumnus UTSW 5 140,871,700 (GRCm39) missense possibly damaging 0.75
unmodulated2 UTSW 5 140,869,537 (GRCm39) splice site probably null
PIT4243001:Card11 UTSW 5 140,894,359 (GRCm39) missense possibly damaging 0.95
PIT4486001:Card11 UTSW 5 140,862,163 (GRCm39) missense probably damaging 1.00
PIT4531001:Card11 UTSW 5 140,892,415 (GRCm39) missense probably damaging 0.99
R0046:Card11 UTSW 5 140,894,279 (GRCm39) missense possibly damaging 0.92
R0285:Card11 UTSW 5 140,872,856 (GRCm39) missense probably damaging 1.00
R0452:Card11 UTSW 5 140,866,125 (GRCm39) missense probably benign 0.01
R1486:Card11 UTSW 5 140,862,274 (GRCm39) missense probably benign
R1710:Card11 UTSW 5 140,888,660 (GRCm39) nonsense probably null
R1733:Card11 UTSW 5 140,892,388 (GRCm39) missense possibly damaging 0.88
R1817:Card11 UTSW 5 140,871,315 (GRCm39) missense probably benign 0.00
R1818:Card11 UTSW 5 140,871,315 (GRCm39) missense probably benign 0.00
R2027:Card11 UTSW 5 140,892,522 (GRCm39) missense probably damaging 0.96
R2436:Card11 UTSW 5 140,868,117 (GRCm39) missense possibly damaging 0.89
R2904:Card11 UTSW 5 140,874,888 (GRCm39) missense probably benign 0.09
R3706:Card11 UTSW 5 140,872,890 (GRCm39) missense probably damaging 0.99
R3708:Card11 UTSW 5 140,872,890 (GRCm39) missense probably damaging 0.99
R4778:Card11 UTSW 5 140,869,537 (GRCm39) splice site probably null
R4877:Card11 UTSW 5 140,871,632 (GRCm39) missense probably damaging 1.00
R4889:Card11 UTSW 5 140,871,700 (GRCm39) missense possibly damaging 0.75
R4910:Card11 UTSW 5 140,860,169 (GRCm39) missense probably damaging 1.00
R5011:Card11 UTSW 5 140,862,275 (GRCm39) missense possibly damaging 0.93
R5257:Card11 UTSW 5 140,862,180 (GRCm39) missense possibly damaging 0.93
R5258:Card11 UTSW 5 140,862,180 (GRCm39) missense possibly damaging 0.93
R5682:Card11 UTSW 5 140,888,666 (GRCm39) nonsense probably null
R5754:Card11 UTSW 5 140,885,524 (GRCm39) missense probably damaging 0.99
R5873:Card11 UTSW 5 140,894,393 (GRCm39) missense probably damaging 1.00
R6184:Card11 UTSW 5 140,884,033 (GRCm39) missense probably damaging 1.00
R6792:Card11 UTSW 5 140,899,064 (GRCm39) missense probably damaging 1.00
R6825:Card11 UTSW 5 140,863,837 (GRCm39) missense probably benign
R7008:Card11 UTSW 5 140,859,148 (GRCm39) missense probably damaging 1.00
R7291:Card11 UTSW 5 140,886,825 (GRCm39) missense probably damaging 1.00
R7376:Card11 UTSW 5 140,883,993 (GRCm39) missense probably benign 0.01
R7526:Card11 UTSW 5 140,899,184 (GRCm39) splice site probably null
R7683:Card11 UTSW 5 140,881,781 (GRCm39) missense probably benign
R7730:Card11 UTSW 5 140,871,751 (GRCm39) missense probably damaging 0.96
R7813:Card11 UTSW 5 140,885,419 (GRCm39) missense probably damaging 1.00
R7831:Card11 UTSW 5 140,859,167 (GRCm39) missense possibly damaging 0.61
R7911:Card11 UTSW 5 140,867,755 (GRCm39) critical splice donor site probably null
R8154:Card11 UTSW 5 140,886,732 (GRCm39) missense probably damaging 1.00
R8224:Card11 UTSW 5 140,888,632 (GRCm39) missense possibly damaging 0.70
R8272:Card11 UTSW 5 140,875,794 (GRCm39) missense probably damaging 1.00
R8714:Card11 UTSW 5 140,899,147 (GRCm39) missense possibly damaging 0.67
R8715:Card11 UTSW 5 140,871,315 (GRCm39) missense probably benign 0.00
R9065:Card11 UTSW 5 140,894,297 (GRCm39) missense probably damaging 1.00
R9211:Card11 UTSW 5 140,869,375 (GRCm39) missense probably benign 0.16
R9215:Card11 UTSW 5 140,866,154 (GRCm39) missense possibly damaging 0.64
R9269:Card11 UTSW 5 140,892,516 (GRCm39) missense probably damaging 0.99
R9385:Card11 UTSW 5 140,871,276 (GRCm39) missense probably benign 0.44
R9421:Card11 UTSW 5 140,869,462 (GRCm39) missense probably damaging 0.97
R9424:Card11 UTSW 5 140,894,395 (GRCm39) missense probably damaging 1.00
R9444:Card11 UTSW 5 140,894,393 (GRCm39) missense probably damaging 1.00
X0067:Card11 UTSW 5 140,871,347 (GRCm39) missense possibly damaging 0.60
Z1177:Card11 UTSW 5 140,883,996 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ATGACCCAGTGCCTCACAGAGATG -3'
(R):5'- TGCATGGTCTGGCAGAGCAATC -3'

Sequencing Primer
(F):5'- GCCTCACAGAGATGGTTGG -3'
(R):5'- CTGGCAGAGCAATCATGAACTTG -3'
Posted On 2013-05-31