Incidental Mutation 'R5636:Spag9'
ID440384
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Namesperm associated antigen 9
Synonymssyd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik
MMRRC Submission 043287-MU
Accession Numbers

Genbank: NM_027569; MGI: 1918084

Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R5636 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location93996091-94126085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94069012 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 342 (D342E)
Ref Sequence ENSEMBL: ENSMUSP00000042271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000132079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024979
AA Change: D199E

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859
AA Change: D199E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 8e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041956
AA Change: D342E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: D342E

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075695
AA Change: D199E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859
AA Change: D199E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 571 605 N/A INTRINSIC
low complexity region 734 750 N/A INTRINSIC
SCOP:d1kb0a2 822 968 3e-5 SMART
Blast:WD40 923 963 7e-18 BLAST
low complexity region 1131 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092777
AA Change: D199E

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859
AA Change: D199E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 254 306 1e-25 PDB
low complexity region 307 340 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 7e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103168
AA Change: D199E

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859
AA Change: D199E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 249 301 1e-25 PDB
low complexity region 302 335 N/A INTRINSIC
coiled coil region 567 601 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
SCOP:d1kb0a2 818 964 3e-5 SMART
Blast:WD40 919 959 8e-18 BLAST
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132079
AA Change: D199E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118850
Gene: ENSMUSG00000020859
AA Change: D199E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 360 394 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138154
Predicted Effect unknown
Transcript: ENSMUST00000156019
AA Change: D191E
SMART Domains Protein: ENSMUSP00000115864
Gene: ENSMUSG00000020859
AA Change: D191E

DomainStartEndE-ValueType
Pfam:JIP_LZII 240 310 1.1e-32 PFAM
coiled coil region 559 593 N/A INTRINSIC
low complexity region 723 739 N/A INTRINSIC
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 94097866 missense probably benign 0.02
IGL01776:Spag9 APN 11 94116727 splice site probably benign
IGL02095:Spag9 APN 11 94108582 missense probably damaging 1.00
IGL02307:Spag9 APN 11 94102160 critical splice donor site probably null
IGL02417:Spag9 APN 11 94116741 missense probably benign 0.27
IGL02480:Spag9 APN 11 94108587 nonsense probably null
IGL02864:Spag9 APN 11 94106661 missense probably damaging 1.00
IGL02976:Spag9 APN 11 94083953 missense probably benign 0.30
IGL02979:Spag9 APN 11 94097364 missense probably benign
IGL03349:Spag9 APN 11 94093509 missense possibly damaging 0.51
dazzle UTSW 11 94093624 nonsense probably null
R0128:Spag9 UTSW 11 94093539 missense probably damaging 1.00
R0418:Spag9 UTSW 11 94091753 splice site probably benign
R1463:Spag9 UTSW 11 94116837 missense probably damaging 1.00
R1593:Spag9 UTSW 11 94097233 missense probably damaging 1.00
R1605:Spag9 UTSW 11 94048539 missense probably damaging 0.99
R1649:Spag9 UTSW 11 94108452 splice site probably null
R1697:Spag9 UTSW 11 93996565 missense probably benign 0.00
R1952:Spag9 UTSW 11 94097358 missense possibly damaging 0.77
R2011:Spag9 UTSW 11 94092375 nonsense probably null
R2012:Spag9 UTSW 11 94092375 nonsense probably null
R2351:Spag9 UTSW 11 94092900 missense probably damaging 1.00
R2367:Spag9 UTSW 11 94116757 missense probably damaging 1.00
R3027:Spag9 UTSW 11 94086377 missense probably null 1.00
R3766:Spag9 UTSW 11 94060283 intron probably benign
R3777:Spag9 UTSW 11 94099026 critical splice acceptor site probably null
R3937:Spag9 UTSW 11 94044417 missense possibly damaging 0.94
R3937:Spag9 UTSW 11 94044479 missense possibly damaging 0.92
R4417:Spag9 UTSW 11 94060346 intron probably benign
R4445:Spag9 UTSW 11 94097253 missense possibly damaging 0.95
R4711:Spag9 UTSW 11 94114351 critical splice donor site probably null
R4799:Spag9 UTSW 11 94048516 missense possibly damaging 0.87
R4799:Spag9 UTSW 11 94048517 missense probably damaging 0.96
R4816:Spag9 UTSW 11 94048599 intron probably benign
R4843:Spag9 UTSW 11 94097818 missense probably damaging 1.00
R5020:Spag9 UTSW 11 94097786 missense probably benign 0.08
R5119:Spag9 UTSW 11 94122722 missense probably damaging 1.00
R5298:Spag9 UTSW 11 94100135 missense probably damaging 1.00
R5304:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5305:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5395:Spag9 UTSW 11 94091751 splice site probably null
R5638:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5654:Spag9 UTSW 11 94090712 missense probably damaging 1.00
R5779:Spag9 UTSW 11 94114253 missense probably benign 0.20
R5814:Spag9 UTSW 11 94082828 missense possibly damaging 0.94
R5912:Spag9 UTSW 11 94044425 missense probably damaging 0.98
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6269:Spag9 UTSW 11 94044507 missense probably benign 0.05
R6294:Spag9 UTSW 11 94093485 critical splice acceptor site probably null
R6389:Spag9 UTSW 11 94086311 missense probably damaging 1.00
R6420:Spag9 UTSW 11 94086302 missense probably damaging 1.00
R6460:Spag9 UTSW 11 94068975 missense probably damaging 1.00
R6482:Spag9 UTSW 11 94093502 missense possibly damaging 0.94
R6860:Spag9 UTSW 11 94081370 missense probably benign 0.25
R7086:Spag9 UTSW 11 94097864 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACAGCCACGAGAGTTTC -3'
(R):5'- CTGCCAGAAGAATGTCCTCC -3'

Sequencing Primer
(F):5'- CAGCCACGAGAGTTTCTAAAAATG -3'
(R):5'- GCACAACATGAACTGATCT -3'
Posted On2016-11-08