Incidental Mutation 'R5637:Cobll1'
ID440409
Institutional Source Beutler Lab
Gene Symbol Cobll1
Ensembl Gene ENSMUSG00000034903
Gene NameCobl-like 1
SynonymsD430044D16Rik, Coblr1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R5637 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location65088339-65239403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65125903 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 337 (D337G)
Ref Sequence ENSEMBL: ENSMUSP00000099787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090896] [ENSMUST00000102726] [ENSMUST00000112429] [ENSMUST00000112430] [ENSMUST00000112431] [ENSMUST00000155916]
Predicted Effect probably benign
Transcript: ENSMUST00000090896
AA Change: D337G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000088412
Gene: ENSMUSG00000034903
AA Change: D337G

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 1.3e-38 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 1023 1034 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102726
AA Change: D337G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099787
Gene: ENSMUSG00000034903
AA Change: D337G

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1060 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112429
AA Change: D337G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108048
Gene: ENSMUSG00000034903
AA Change: D337G

DomainStartEndE-ValueType
Pfam:Cobl 148 239 5.4e-49 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112430
AA Change: D336G

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108049
Gene: ENSMUSG00000034903
AA Change: D336G

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
Pfam:Cobl 185 263 1.3e-38 PFAM
low complexity region 331 342 N/A INTRINSIC
low complexity region 425 437 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112431
AA Change: D337G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108050
Gene: ENSMUSG00000034903
AA Change: D337G

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155916
SMART Domains Protein: ENSMUSP00000115065
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
Pfam:Cobl 206 297 2.4e-37 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,152,852 N1267D probably benign Het
Acmsd T C 1: 127,766,313 F327L probably damaging Het
Adgrl3 C A 5: 81,693,544 S824Y probably damaging Het
AF366264 A T 8: 13,837,713 M126K possibly damaging Het
Arfip2 A G 7: 105,637,163 M144T probably damaging Het
Arhgap32 A G 9: 32,247,206 N179S probably damaging Het
Ash2l T C 8: 25,827,311 Y249C probably damaging Het
Ccndbp1 A G 2: 121,011,684 T141A probably benign Het
Cd177 T A 7: 24,756,323 H258L probably benign Het
Celsr3 T C 9: 108,837,133 W1956R probably damaging Het
Cep295 T C 9: 15,333,812 probably null Het
Cngb1 T C 8: 95,257,921 H420R probably damaging Het
Cobl C T 11: 12,296,531 probably benign Het
Dmrta1 A G 4: 89,688,831 N175D probably benign Het
Dnah7b G T 1: 46,356,514 V3859L possibly damaging Het
Dnah7c A G 1: 46,760,361 probably null Het
Dusp4 C A 8: 34,817,297 H255Q probably damaging Het
Evx1 T C 6: 52,315,766 V134A possibly damaging Het
F12 T C 13: 55,422,415 K93E possibly damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Frem2 A G 3: 53,652,937 I1383T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr158 A G 2: 21,783,272 I575V probably benign Het
Hdc A G 2: 126,616,189 V71A probably benign Het
Helb G A 10: 120,105,448 T445M probably benign Het
Inppl1 A T 7: 101,828,848 S652R probably benign Het
Itpripl1 T C 2: 127,142,124 D26G probably damaging Het
Klc1 T A 12: 111,774,408 L106H probably damaging Het
Klhl25 T A 7: 75,865,792 probably null Het
Krt6a T C 15: 101,692,279 D318G probably benign Het
Lrp2 T C 2: 69,472,418 N2989S probably damaging Het
Lta4h A G 10: 93,468,869 probably null Het
Man1c1 A G 4: 134,591,424 S251P probably damaging Het
Mapre2 T C 18: 23,753,862 probably benign Het
Mfap3l A T 8: 60,656,787 I66F probably damaging Het
Mvk A G 5: 114,455,942 E286G possibly damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1275 T A 2: 111,231,111 K227N probably benign Het
Olfr307 G A 7: 86,335,604 T264I probably benign Het
Olfr867 A T 9: 20,054,983 V160D possibly damaging Het
Pcdh9 A G 14: 93,885,762 F991L possibly damaging Het
Pcdha9 T C 18: 36,998,373 V165A probably benign Het
Pcsk6 A G 7: 65,968,997 H437R probably damaging Het
Pfas C T 11: 68,993,323 V589M probably damaging Het
Prpf40a A G 2: 53,156,734 V288A possibly damaging Het
Rnf183 T C 4: 62,428,150 D137G probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Scap G A 9: 110,381,572 A991T possibly damaging Het
Sdk2 C A 11: 113,833,179 V1222F probably damaging Het
Sdr16c6 T A 4: 4,063,232 N181I possibly damaging Het
Serpinb7 A T 1: 107,428,307 D20V probably damaging Het
Sh3bp2 C A 5: 34,561,048 R531S possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox2 A G 3: 34,650,528 N38S probably benign Het
Spg7 C A 8: 123,094,575 Q680K possibly damaging Het
Styk1 T C 6: 131,300,418 E331G possibly damaging Het
Tkfc G A 19: 10,594,533 R380W probably benign Het
Trib3 A G 2: 152,338,490 F261S probably damaging Het
Ubr1 T A 2: 120,963,517 Q62L possibly damaging Het
Vmn2r54 T C 7: 12,615,369 Y762C probably benign Het
Vmn2r97 T A 17: 18,947,366 Y627* probably null Het
Zfp12 A G 5: 143,245,696 K625E probably damaging Het
Zw10 T C 9: 49,057,650 V38A probably damaging Het
Other mutations in Cobll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cobll1 APN 2 65126013 missense probably damaging 1.00
IGL01074:Cobll1 APN 2 65107848 missense probably damaging 1.00
IGL01093:Cobll1 APN 2 65098237 missense probably damaging 1.00
IGL02411:Cobll1 APN 2 65097740 missense probably damaging 1.00
IGL02419:Cobll1 APN 2 65151048 missense probably damaging 1.00
IGL02550:Cobll1 APN 2 65107863 missense probably damaging 1.00
IGL02607:Cobll1 APN 2 65151085 missense probably damaging 0.98
IGL02829:Cobll1 APN 2 65126045 missense probably damaging 1.00
IGL02802:Cobll1 UTSW 2 65098319 missense probably damaging 0.99
R0313:Cobll1 UTSW 2 65095744 nonsense probably null
R0314:Cobll1 UTSW 2 65089521 missense possibly damaging 0.81
R0322:Cobll1 UTSW 2 65102098 missense possibly damaging 0.84
R0846:Cobll1 UTSW 2 65102065 splice site probably null
R1163:Cobll1 UTSW 2 65098279 missense probably damaging 0.96
R1242:Cobll1 UTSW 2 65151169 critical splice acceptor site probably null
R1364:Cobll1 UTSW 2 65126310 splice site probably benign
R1445:Cobll1 UTSW 2 65099136 missense probably damaging 1.00
R1610:Cobll1 UTSW 2 65133642 missense probably damaging 1.00
R1836:Cobll1 UTSW 2 65126236 missense probably damaging 1.00
R2102:Cobll1 UTSW 2 65098210 missense probably damaging 1.00
R3154:Cobll1 UTSW 2 65107050 missense probably benign 0.00
R4580:Cobll1 UTSW 2 65151073 missense probably benign 0.00
R4638:Cobll1 UTSW 2 65099237 missense probably benign 0.03
R4684:Cobll1 UTSW 2 65099028 missense possibly damaging 0.90
R4906:Cobll1 UTSW 2 65097693 missense probably benign 0.01
R4923:Cobll1 UTSW 2 65099258 missense possibly damaging 0.87
R5100:Cobll1 UTSW 2 65125901 missense probably benign 0.26
R5269:Cobll1 UTSW 2 65133771 nonsense probably null
R5419:Cobll1 UTSW 2 65103357 missense possibly damaging 0.57
R5745:Cobll1 UTSW 2 65098457 missense probably damaging 0.99
R5777:Cobll1 UTSW 2 65103268 missense probably benign 0.27
R6303:Cobll1 UTSW 2 65098033 missense possibly damaging 0.68
R6471:Cobll1 UTSW 2 65107884 missense probably damaging 1.00
X0020:Cobll1 UTSW 2 65103322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTGCCAGTAACTATTCTACTGAG -3'
(R):5'- GTCCATCTTTCACGAGGTCC -3'

Sequencing Primer
(F):5'- TGGTTACAAGCCACCATGTG -3'
(R):5'- TCTTTCACGAGGTCCAACAC -3'
Posted On2016-11-08